1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
satela [25.4K]
4 years ago
5

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

Biology
1 answer:
Reika [66]4 years ago
3 0

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

You might be interested in
The sum of the genetic traits in this population is<br> called its
Murljashka [212]

Answer:

gene pool

Explanation:

bc like, well i didnt make the name

5 0
3 years ago
Read 2 more answers
Which conditions are required for natural selection? Select three options.
Umnica [9.8K]
Four conditions are needed for natural selection to occur: reproduction, heredity, variation in fitness or organisms, variation in individual characters among members of the population. If they are met, natural selection automatically results.
6 0
3 years ago
Read 2 more answers
What causes the different time zones?
Korvikt [17]

Answer:

The need for continental time zones stemmed directly from the problems of moving passengers and freight over the thousands of miles of rail line that covered North America by the 1880s. Since human beings had first begun keeping track of time, they set their clocks to the local movement of the sun.

5 0
3 years ago
What binds with blood types A, B, AB, and O?<br><br> thank you!
Pani-rosa [81]

Explanation:

AB blood type is very rare

thank you!

3 0
3 years ago
How does the haploid form of ulva switch to its diploid form?.
Nikolay [14]
Gametophytes produce cells that undergo mitosis to produce gametes that fuse to form a zygote.
6 0
2 years ago
Other questions:
  • Please help me ASAP !!!
    10·1 answer
  • Covalently bonded atoms that function as a whole and have either a surplus or deficit of electrons, giving them a positive or ne
    9·1 answer
  • The cells that result from the early duplication and division processes are called stem cells, which are able to produce any oth
    9·1 answer
  • In the above diagram of an animal cell, what is the function of organelle <br><br> 4
    10·1 answer
  • N₂ has a shorter inter-nuclear distance than O₂ because 1. nitrogen is less electro-negative than oxygen. 2. False; O₂ has a sho
    9·1 answer
  • The world health organization recommends breastfeeding until age ______, with solid foods added at ______.
    13·1 answer
  • Researchers can manipulate the genes of a mouse so that a single gene in a single tissue either produces an inactive protein (a
    11·1 answer
  • Which of the following are thought to have been engulfed by prokaryotic cells and evolved into chloroplasts?
    6·2 answers
  • What killed the great beasts of North America
    14·1 answer
  • Plants contain the carbohydrates starch and cellulose. in the spring when stem growth is at its fastest rate, cellulose producti
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!