1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
satela [25.4K]
4 years ago
5

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

Biology
1 answer:
Reika [66]4 years ago
3 0

Answer:

Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT

TTAAGCGGCCATAATCTGCAA

Explanation:

You might be interested in
Proteins are
lutik1710 [3]
The answer as far as I can tell is B). Everything else is silly lol.
3 0
3 years ago
Read 2 more answers
Limiting Factors that are Density Dependent are affected by the size of the population
Kobotan [32]

Answer:

this would be true

Explanation: these factors increase whi is what you asked right

3 0
3 years ago
I am a nucleic acid.<br> ONLY RNA<br> ONLY DNA<br> BOTH DNA AND RNA
Ksenya-84 [330]

Answer:

both

Explanation:

both classes are na's

6 0
3 years ago
Cuantas cromosomas sexuales tiene un perro
vichka [17]

Answer:  es decir un total de 78,

Explanation:

Los perros tienen 39 pares de cromosomas, es decir un total de 78, de estos 78 cromosomas 39 contienen la información genética de la madre y las otras 39 la información genética del padre. Desde la fertilización del óvulo, comienza el proceso de crecimiento, los núcleos de las células comienzan una multiplicación exacta, de esta forma crean nuevas células.  El número de cromosomas en cada especie es constante, salvo que se padezca de algún síndrome el número siempre será el mismo.

6 0
3 years ago
DNA Structure and Function Study Guide AP Biology 1. Match each scientist listed below with their contribution to the study of D
Norma-Jean [14]

Answer:

E. Erwin Chargaff >>  Discovered that there were equal amounts of the nitrogen bases A T and C G in a human body cell; concluded that A paired with T and C paired with G

B. Hershey and Chase>> Did experiments with viruses to determine that DNA, not protein, is the genetic material of a cell

A. Frederick Griffith>> Did experiments with S and R strain pneumonia bacteria to determine that DNA is the genetic material of a cell

C. Rosalind Franklin >> Took x-ray crystallography images of a DNA molecule.

Explanation:

Chargaff rules helped to determine the double helix structure of the Deoxyribonucleic acid (DNA), i.e., the genetic material of prokaryotic and eukaryotic organisms. Chargaff indicated that DNA from any species contains a 1:1 ratio of purine bases (Adenine and Guanine) and pyrimidine bases (Cytosine and Thymine). Hershey and Chase provided evidence that the DNA, instead of protein, is the hereditary material. Hershey and Chase used radioactive phosphorus-32 in order to label the DNA of specific bacteriophages (T2), and they discovered that the DNA was responsible to generate progeny inside infected bacteria (i.e., DNA was hereditary material). Frederick Griffith observed that DNA molecule was the transforming factor that could be transferred to innocuous <em>Streptococcus pneumoniae</em> bacteria in order to convert them into deadly bacteria. Finally, Rosalind Franklin obtained the first X-ray image that showed the diffraction pattern of a crystallized DNA molecule, which was used by Watson and Crick to propose that DNA had a double helix structure.

8 0
3 years ago
Other questions:
  • Which best describes the functional role of cyclic adenosine monophosphate?
    14·1 answer
  • Which of the following best defines weather?
    14·2 answers
  • What is the function of the kidneys? to filter waste material from the blood to convert glucose into glycogen to add oxygen to t
    12·1 answer
  • A ball slows as it rolls up a hill. Which is this an example of?
    5·2 answers
  • sports such as soccer involve running, stopping, jumping, and kicking. discuss how friction helps players
    8·2 answers
  • A client reports that she has a terrible headache that doesn’t go away. the client keeps asking what time her son will be in to
    15·1 answer
  • This type of renewable energy makes plants grow, helping them to make food and oxygen?
    14·1 answer
  • Which of the following is true regarding tissue?
    9·1 answer
  • 3. Why is it impossible to see a hybrid (or heterozygous) white mouse?
    15·2 answers
  • How are fire extinguishers helpful?​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!