1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mojhsa [17]
3 years ago
6

Which of the following is an example of homeostasis?

Biology
2 answers:
Katyanochek1 [597]3 years ago
8 0
C, when you are sick and your body temperature increases
Fittoniya [83]3 years ago
6 0

Answer:

C) When you are sick, your body temperature increases and you get a fever.

Explanation:

You might be interested in
An arthropod's exoskeleton performs all of the following functions except
Mars2501 [29]
A. production of gametes
3 0
3 years ago
Read 2 more answers
Hurry! Will mark brianlest if correct, worth 11 points! Which best explains the zygote?
Usimov [2.4K]

Answer:

The correct answer is A. It has a diploid number of chromosomes.

4 0
3 years ago
Read 2 more answers
In the figure showing gene expression , what should replace label b ?
xz_007 [3.2K]

The correct answer is C. Translation.

The given figure is the scheme of the gene expression. It provides the flow of genetic information from a DNA sequence to a protein synthesis inside cells. This process of flow of genetic information from DNA to RNA is called transcription and the process of flow of genetic information from RNA to protein is called translation.

Thus in given figure label A is to be replaced by transcription and label B is to replace by translation.

7 0
3 years ago
The dermis:
Vladimir79 [104]

Answer:

D. is responsible for most of the skin's structural strength.

Explanation:

A. contains no blood vessels.

False. The dermis contains blood vessels together embedded in it along with the sweat and sebaceous or oil glands, hair follicles, and nerve endings.

B. functions as a padding and insulation.

False. The fat layer that is located below the dermis is the one responsible for padding and insulation.

C. is divided into three distinct layers

False. The dermis is divided into only two separate layers. These are the papillary layer or the upper layer and the reticular layer or the lower layer.

D. is responsible for most of the skin's structural strength.

Yes, the dermis functions for providing the skin's structural strength because of it's thick fibrous and elastic tissue layer. This layer consists primarily of collagen and elastin that also allows for the skin's flexibility.

E. is made of epithelial tissue.

False. The dermis is made up of fibrous and elastic tissue. It is the epidermis which is composed of the epithelial tissue.

6 0
4 years ago
Read 2 more answers
Competent cells
kati45 [8]

Answer: Competent cells are able to take up naked DNA, they occur naturally and can be created in the laboratory

Explanation: Competent cells are cells that can modify its genetic make up and take other DNA using transfomation. Competent cells are commonky made from e.coli because it can replicate faster, readily available for use. DNA is cleavedusing restriction enzymes making up sticky ends.

4 0
3 years ago
Other questions:
  • Besides sugar, what else is a product of (given off during) photosynthesis?
    13·2 answers
  • A single genetic locus that controls more than one trait is said to be __________.
    10·1 answer
  • An unknown DNA molecule was cleaved using several restriction enzymes individually and in various combinations. The DNA fragment
    14·1 answer
  • A tan or a sunburn is the result of exposure to ultraviolet light.<br> O True<br> O False
    6·2 answers
  • What is the purpose of the proper handling of experimental subjects?
    11·1 answer
  • Si se quisiera usar una droga destinada a impedir la unión de la hormona antidiurética con su receptor, ¿sobre qué órgano deberí
    8·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is the percentage of water in blood?
    8·2 answers
  • Digestion is primarily controlled by the _____.
    12·2 answers
  • In a particular variety of corn, kernel corn is controlled by a single gene with two alleles. the dominant allele results in pur
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!