1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Iteru [2.4K]
3 years ago
14

How are oxygen and carbon cycled between plants and animals?

Biology
2 answers:
Brums [2.3K]3 years ago
7 0
We each depend on each other too give us what we need to survive 
tamaranim1 [39]3 years ago
6 0
Animals use oxygen for cellular respiration.
Plants release oxygen during photosynthesis, but use it during cellular respiration.
You might be interested in
Which things are abiotic factors that are also basic needs for the Kingdom Plantae? Check all that apply.
PtichkaEL [24]

Answer:

A and C

Explanation:

4 0
3 years ago
Cells must be alive to use energy and do work dose passive transport occur in a cell that is dead? Why or why not?
Orlov [11]

Answer:

<h3>Yes, Passive transport can occur in dead cells.</h3>

Explanation:

For passive transport to occur, a concentration gradient has to be formed across a permeable or semi-permeable membrane. If the cell membrane of the dead cell, which is a semipermeable membrane, is intact and a concentration gradient has formed on both sides, passive transport can occur.

A concentration gradient is the difference in the concentration of solute molecules  across the membrane. Passive transport will allow solute molecules to travel from the higher concentration of the solute to the lower concentration across a membrane till equilibrium is reached, that is, both the sides of the membrane has equal concentration of the solute.

The transport of the solvent can occur as well, from higher concentration to lower concentration.  

6 0
3 years ago
Why is damage caused to an ecosystem by adding fertilizer
Pie
Damage is caused to an ecosystem by adding fertilizer because some of the substances to the fertilizer is toxic or create bad reactions. 


3 0
3 years ago
MtDNA is transferred along material lineage
lorasvet [3.4K]

Answer:

True

Explanation:

mtDNA is passed from mother to child.

5 0
3 years ago
Read 2 more answers
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Other questions:
  • Which of the following best describes the result of meiosis II?
    7·2 answers
  • Chloroplasts are found in what type of cells?
    11·2 answers
  • Based on the diagram, the left infraorbital foramen is ___________ and ___________ relative to the nasal bone.
    8·1 answer
  • What do biologists use to establish whether or not two organisms are of the same species?
    6·2 answers
  • The t locus is involved in the production of tails in a mouse; tt individuals are without tails, whereas TT and Tt have tails. T
    9·1 answer
  • Where are most of the ATP molecules produced in aerobic respiration?
    13·1 answer
  • Epigenetics is defined as the
    13·1 answer
  • Which of the following enzymes is NOT part of DNA replication?
    10·1 answer
  • Explain how seasonal fires benefit grassland ecosystems
    9·1 answer
  • Process of diffusion​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!