1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena-2011 [213]
4 years ago
14

Why is xylem known as a dead tissue

Biology
1 answer:
IgorLugansk [536]4 years ago
4 0
Because it’s main organelles are missing
You might be interested in
When you only grow enough food<br> to support your family, it is<br> known as
liberstina [14]

Answer:

subsistence farming

Explanation:

subsistence farming. agriculture that produces just enough to feed the farmer's family with little left over to sell.

7 0
3 years ago
The skeletal and muscular systems are similar because
AveGali [126]

Answer:

The bones of skeletal system serve to protect the body's organs and support the weight of the of the body ,giving the body it's shape

Explanation:

The muscles of the muscular system attach to these bones, pulling on them to allow for movement of the body

6 0
3 years ago
Each year, an average person in the United States is exposed to a radiation level of _____.
Bond [772]
The average person in the U.S. is exposed to a radiation level of .62 rem
6 0
4 years ago
Read 2 more answers
What do proteins do when they enter cells?
Tomtit [17]

Answer:

The immune system is made up of two armies of cells

Explanation:

I think so~~

6 0
3 years ago
A couple with a newborn baby is troubled that the child does not resemble either of them. suspecting that a mix-up occurred at t
BigorU [14]
The result of this would greatly depend on the genotype of the parents. If either the father is homozygous Type A and the mother is homozygous Type B, then yes, a mix up has occurred because the probability of having an offspring with the blood type O would be zero. But if both of them are heterozygous, then having a child with type O will be possible with a 25% probability. 
7 0
4 years ago
Other questions:
  • How many different proteins, each composed of 5 amino acids, can be constructed using the 20 different amino acids found in prot
    8·1 answer
  • Water is harnessed to move a turbine. How is energy converted in this case?
    6·1 answer
  • What happens when a part of the lymphatic system does not function?
    10·1 answer
  • The cells that are on each side of a stomata and open and close it like a mouth are called _____.
    8·1 answer
  • Coombs’ reagent is an antiserum with antibodies that bind to human ________.
    7·1 answer
  • Write the complementary sequence to the following DNA strand: AATTCGCCGGTATTAGACGTT
    5·1 answer
  • As biodiversity increases in an ecosystem, the ecosystem?
    13·1 answer
  • ??? help ??? please anyone
    10·1 answer
  • How does your diet (the different types of foods you eat) affect the water cycle?
    8·1 answer
  • What is the MAIN function of a vacuole?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!