1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mote1985 [20]
2 years ago
13

A major factor which aids in the understanding of contemporary distribution patterns of plants and animals is ________. gerograp

hy
Biology
1 answer:
Troyanec [42]2 years ago
6 0

a major factor is abiotic factors such as climatic conditions,edaphic factors such as soil trype and social factors such as availability of water and land use,


Biogeography is the study of distribution of plants and animals in a particular region. Biogeographers looks out for the effects of biotic and abiotic factors on the effect of the patterns of distribution.

You might be interested in
Consider two different traits in mice affecting tail length and fur color. A two-factor cross was made involving true-breeding m
Stells [14]

Answer:

See the answer below

Explanation:

Null hypothesis: The two genes are independently assorting and therefore, are not linked to each other.

Let A represents the allele for tail length and B for fur color. Long-tail A is dominant over short tail a while brown fur B is dominant over white fur b.

For the first cross involving true-breeding mice:

    AABB   x   aabb

F1         AaBb (long tails and brown fur)

For the second cross:

      AaBb   x   aabb

4 AaBb - Long-tail, brown fur

4 Aabb - Long tail, white fur

4 aaBb - short tail, brown fur

4 aabb - short tail, white fur

Since the phenotypic ratio from the cross is 1:1:1:1, if the null hypothesis was to be true, it means that the expected phenotype ratio should be 1:1:1:1.

In order to test this hypothesis, we use Chi-square:

phenotype                           O            E                 X^2  

Long-tail, brown fur           118          97.5        \frac{(118-97.5)^2}{97.5} = 4.31

Long tail, white fur              77           97.5             4.31

short tail, brown fur             81           97.5              2.79

short tail, white fur              114           97.5              2.79

Total                                                                          14.2

Degree of freedom = 4 - 1 = 3

Critical Chi-square value = 7.815

The calculated Chi-square value is more than the critical value, hence, the null hypothesis is rejected.

8 0
3 years ago
What can help digestion give some examples and explain in short.
Katen [24]

Answer:Terms in this set (10)

Mouth

Teeth chop food & saliva breaks down food

Esophagus

Tube that connects mouth to the stomach (peristalsis)

Stomach

Organ that releases acid and juices & mixes with food to create chymes

Small Intestine

Greatest amount of digestion takes place (if taken out, it would be 21ft long) (takes 4hrs to get to the small intestine)

Liver

Gland that releases bile and filters poisonous waste

Gall Bladder

Small organ that stores bile (you can live without it)

Pancreas

Gland that produces digestive enzymes and insulin

Large Intestine

(colon) Tube extending the small intestine where your indigestive food is ready for elimination

Rectum

Short tube at the end of the large intestine

Anus

Opening to the outside of the body

Explanation:

The organs of the digestive system are the mouth, esophagus, stomach, pancreas, liver, gallbladder, small intestine, large intestine and anus. Recognizing how these organs work together to digest food is key to understanding how digestion works.

7 0
2 years ago
Read 2 more answers
Why does DNA need to be copied into mRNA?
larisa86 [58]

mRNA will serve as reference book that contains information as the DNA and its sequence is complementary to the DNA template.

The transfer of information in a DNA strand to a new molecule of messenger RNA is known as transcription. Thus, the process of transcription is carried out by an enzyme called RNA polymerase and a number of accessory proteins called transcription factors. However, DNA is copied into mRNA because mRNA will serve as reference book that contains information as the DNA and its sequence is complementary to the DNA template.

3 0
3 years ago
once a consumer gains nitrogen nutrients from animals or plants it recycles these nutrients back to each by
SSSSS [86.1K]

Answer:

Decomposers get nutrients and energy by breaking down dead organisms and animal wastes. Through this process, decomposers release nutrients, such as carbon and nitrogen, back into the environment. These nutrients are recycled back into the ecosystem so that the producers can use them

Explanation:

8 0
3 years ago
Read 2 more answers
In the following choices, the one that is NOT a function of the skeletal
kondaur [170]

Answer:

I'm pretty sure it's transport blood cells

3 0
3 years ago
Other questions:
  • Describe generally what happened to each spot of each type of ink. which had the most pigments?
    13·1 answer
  • How does waste move from the kidney to the bladder in the human excretory systems
    10·2 answers
  • Biological classification how are organisms grouped sorted and classified answers key
    6·1 answer
  • How are the NADPH and GA3P molecules made during photosynthesis similar?
    15·1 answer
  • • nitrogen-fixing • producer • biosphere • consumer • biotic factor • heat • condensation • parasitism • commensalism • neritic
    10·1 answer
  • What is long, thread-like extensions that grow from the protist to reach nutrients?
    11·2 answers
  • CAN SOMEONE PLZ ANSWER THIS
    12·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Which of the following best describes where one could find a single trait of an organism?
    9·1 answer
  • What controls traits and inheritance?<br> gametes<br> nucleic acids<br> proteins<br> temperature
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!