1. TTGCATGCTAGCTACGTGTACGTACCGATGCG
2. GGGCCCATACGTACATGCATGCAGCATATAGC
3. GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
You should double check those to make sure I didn't make any mistakes. Hope this helps!
A) Thylakoid
B) Lumen
C) Granum
D) Stroma
Answer:
Airborne transmission may occur if patient respiratory activity or medical procedures generate respiratory aerosols. These aerosols contain particles that may travel much longer distances and remain airborne longer, but their infective potential is uncertain. Contact, droplet and airborne transmission are each relevant during airway manoeuvres in infected patients, particularly during tracheal intubation.
Explanation:
Founder effect is the example of migration of a random few individuals from one population to a new area to establish a new population.Thus, option C is correct.
What is migration?
Migration is defined as movement of individuals from one place to another in search of employment and livelihood.Some people lives permanently after migration and some returns back to the native place.
Internal migration is the type of migration in which people migrate within state and country.
External migration is the migration to different state and country.
The phenomenon of moving into new place is known as immigration.
Seasonal migration is the migration in which animals or humans migrate in a particular season due to climatic condition.
Therefore,migration of a random few individuals from one population to a new area to establish a new population is an example of founder effect.
Learn more about migration here:
brainly.com/question/2180770
#SPJ4
The question is seems to be incomplete the question is may be like that
Migration of a random few individuals from one population to a new area to establish a new population is an example of _
A) bottleneck effect
B) mutation
C) founder effect
D) selection
