1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DedPeter [7]
3 years ago
14

you are looking through a microscope at some cells.each of the cells have a different structure. what can you infer about the ce

lls

Biology
1 answer:
mylen [45]3 years ago
5 0
C they have different functions i think its the most accurate (btw this is MY opinion)
You might be interested in
Neptune has a diameter of 30,778 miles. What is its diameter in kilometers?
Alex777 [14]

Explanation:

30 778×1.6

=49 244.8Km

7 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
A specialized protein in saliva breaks up starch molecules in food into smaller chains of simple sugars. In this reaction, which
Anarel [89]

Answer:

option d, b, c

Explanation:

Starch molecules taken into the mouth from food substances are processed to an extent of 30% of its digestion. this is carried out by a specialized protein/ an enzyme that is present in the saliva; called  amylase or ptyalin. this enzyme acts on the substrate molecule which in this case is starch molecules and convert it into smaller chains of simple sugars that includes maltose and dextrin which is digested in the small intestine.

5 0
3 years ago
According to the _______ hypothesis, the moon formed far away from the earth and was later captured by the earth's gravity. The
Anit [1.1K]

Answer:

capture

giant impact hypothesis

electromagnetic spectrum

cold

14

The moon's mass is much lower than the earth's; therefore, its gravity isn't strong enough to hold an atmosphere. This lack of an atmosphere and the moon's small size allowed it to become cool enough to the point at which it completely solidified. Thus, the moon doesn't have any plate tectonic activity.

Explanation:

8 0
3 years ago
Read 2 more answers
In fruit flies long wings are dominant to short wings what is the genotype of each parent A) WW;Ww B)Ww;ww C) Ww;Ww D)WW;WW
Contact [7]
Your answer is C) Ww;Ww
3 0
3 years ago
Other questions:
  • Describe the competitive exclusion principle, and explain how competitive exclusion may affect community structure.
    11·1 answer
  • The incidence of cystic fibrosis, a recessive genetic disorder in the Caucasian population of United States, is 1 in every 2,500
    11·1 answer
  • What does Genetic drift do?
    7·1 answer
  • Ever since Allison vomited all over her boyfriend after she ate a chicken salad sandwich that had been sitting in the sun all da
    7·1 answer
  • Ensuring that enough money and credit are available to sustain economic growth without inflation is the primary mission of the _
    5·1 answer
  • Which of the following is not a possible consequence of the introduction of invasive species? a. changes to the existing gene po
    15·2 answers
  • Someone knows this for living environment
    8·2 answers
  • Red blood cells in A-positive individuals:
    6·1 answer
  • Transpiration is the loss of oxygen through a plant’s leaves true or false
    6·1 answer
  • Describe the similar seasonal changes between the butterfly in Florida and the butterfly in Wyoming during
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!