1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Agata [3.3K]
3 years ago
11

What is the main fuel of a main sequence Star

Biology
1 answer:
NikAS [45]3 years ago
8 0
If we're asking for elements, it's helium and hydrogen.
You might be interested in
Help, a very strong form of cocaine is ______.
Vlada [557]

Cannabis maybe. Hope this is for school lol

3 0
3 years ago
Read 2 more answers
Plants also use cellular respiration<br><br> A. True<br><br> B. False
dimulka [17.4K]

Answer:

A. True

Explanation:

Yes, the plants use cellular respiration. So, option (A) is the correct answer.

4 0
3 years ago
The heart is ____ to the stomach and ___ to the brain.
Korolek [52]
The heart is superior to the stomach and inferior to the brain
4 0
3 years ago
Read 2 more answers
1.where does the energy required the process of cellular respiration come from?
MatroZZZ [7]
The energy from cellular respiration comes from food and air. The reactants first cellular respiration are oxygen and glucose. Glucose is a form of sugar and comes from food, and oxygen is found in air.

The main reactants or cellular respiration, as stated above, are oxygen and glucose.

During the first stage of cellular respiration, which takes place in the cytoplasm, a small amount of energy is produced when glucose is broken down into smaller particles.
3 0
3 years ago
Choose one nonrenewable energy source and one renewable energy source. Describe how the use of each source affects the environme
cluponka [151]
A tree is renewable because it can re grow and make more trees.
Iron is non renewable because it can’t make any more things, you can just use it that one time
7 0
3 years ago
Read 2 more answers
Other questions:
  • Corals are polyps of coelenterates (cnidarians) that contain numerous algae in their tissues. the algae contain photopigments th
    14·1 answer
  • When the seafloor spreads apart volcanoes and ridges are formed because
    9·1 answer
  • (PLZ READ, TRANSLATE IF U HAVE TOO)
    8·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which type of soil can retain the greatest amount of water?
    9·1 answer
  • Which atmosphere has the solid water on earths surface
    11·2 answers
  • Describe the general trend of this graph
    6·1 answer
  • DNA: TTCGCTTTCT mRNA: Amino acid:
    12·1 answer
  • What was the invasive species on Christmas Island that changed the ecosystem?
    7·2 answers
  • How the structure of a muscle cell is related to its functio​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!