1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kaylis [27]
3 years ago
12

How do plants on Earth affect the amount of carbon in Earth’s atmosphere?

Biology
1 answer:
Elza [17]3 years ago
4 0

Answer:Plants take carbon from the atmosphere to photosynthesize. Occurs when Earth's atmosphere traps in solar radiation (heat). ... Increased amounts of carbon in the hydrosphere can change the acidity of the water, which can affect the organisms living in it.

Explanation:

You might be interested in
Mario and several friends spend a day at the beach. While watching the ocean waves crashing to shore, Mario wonders how much of
Zinaida [17]

Answer:

A

Explanation:

The correct answer here would be that <u>less than 3 percent of Earth's water is freshwater containing no salt.</u>

<em>Generally speaking, about 71 % of the earth is made up of water. Out of this percentage, approximately 97 % is found in the oceans with less than 3 % being freshwater. About 68.7 % of the freshwater is locked-up as glacier and ice, 30.1 % is groundwater, while the remaining 1.2 % represents surface and other forms of freshwaters which include ground ice and permafrost, lakes, atmosphere, rivers, swamps and marshes, soil moisture, and the freshwater in living organisms. </em>

The correct option is A.

3 0
3 years ago
Scientific notation exercises
Vsevolod [243]

Answer:

pls show a pic of that ok

4 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
why do you think using a person's own cell to make a new organ or tissue for them will increase the chance that their body will
yuradex [85]

Answer:

In my personal opinion, I think this is possible because your body already knows the cell. It is already familiar with it.

Explanation:

5 0
3 years ago
When Na2CO3 is heated it breaks down into CO2 and Na2O in an _______ reaction
slamgirl [31]
This is called a decomposition reaction
7 0
3 years ago
Other questions:
  • How are rain and snow measured
    5·1 answer
  • Which of the following might ecologist study?
    10·1 answer
  • Which of the following describes a rapidly expanding population?
    10·2 answers
  • Which kind of evolution occurs over a relatively short period of time
    13·1 answer
  • Which most accurately describes the basis of the scientific method
    8·2 answers
  • The products of one reaction may be the reactants in another.<br><br> True <br> False
    5·1 answer
  • What organelle releases this stored energy in animal cells? (SC.912.L.14.3)
    14·1 answer
  • Which macromolecule and function are correctly matched? *
    13·1 answer
  • Which answer choice is light bouncing?
    11·1 answer
  • What is the process of mountain building called?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!