1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yawa3891 [41]
3 years ago
12

The DNA molecule is made up of numerous genes. true or false

Biology
2 answers:
Minchanka [31]3 years ago
6 0
I think this answer is "true".
mihalych1998 [28]3 years ago
5 0
The answer to this question is true
You might be interested in
How many chromosomes are in the body cells of an organism that has a diploid number of 8
pantera1 [17]

Answer:

there are 16 chromosomes

6 0
3 years ago
True or false Cycads are mostly found in tropical regions
egoroff_w [7]

Answer:

true i think

Explanation:

5 0
2 years ago
for a behavior to evolve under the influence of natural selection, that behavior must be a. directed by genes. b. neither adapti
vazorg [7]
A. Directed by genes
6 0
2 years ago
Read 2 more answers
How aquired traits and inherited traits simular
ohaa [14]

Hey there! Simply put, inherited traits come from an ancestor, and acquired are ones that are earned through adaption. Hopefully that makes sense. :)

6 0
3 years ago
Which of the following outcomes would be most likely if the membrane of a cell were no longer selectively permeable? Harmful sub
Ray Of Light [21]
If the membrane of a cell were no longer selectively permeable then "<span>The cell would die as it would not be able to regulate which substances could enter and leave", since a selectively permeable membrane allows both things to enter and leave for the cell's survival. </span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Help with this please
    14·2 answers
  • A student's tonsils become infected and she has them removed. What condition does she need to be careful of in the future?
    10·1 answer
  • Why is sample size important?
    5·1 answer
  • help plss! What is metabolism? Provide a real-life example of metabolism to support your description.
    15·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Organisms with gametes of the same shape but different sizes
    7·1 answer
  • Which animals have had the bovine growth hormone injected into them in order to produce larger individuals?
    6·1 answer
  • Epinephrine causes the enzyme glycogen phosphorylase to break down glycogen within a cell. Epinephrine performs this task on int
    15·1 answer
  • A.) Give one example of how animals respond to their environment
    15·2 answers
  • Q40.is a proposed explanation for an observation.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!