1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mkey [24]
3 years ago
9

How do I win a warzone match?

Biology
2 answers:
Leona [35]3 years ago
7 0

Answer:

warzone? what is warzone?

Explanation:

igomit [66]3 years ago
7 0

Answer:

you get better

Explanation:

You might be interested in
What are the responsibilities of the region of the brain highlighted below?
emmasim [6.3K]

Answer:

regulating important involuntary bodily2

function such as blood pressure ,heart rate,

breathing,and swallowing

8 0
3 years ago
Read 2 more answers
How many chromosomes will this daughter cell have?
eimsori [14]

Answer:

Answer: 10 Chromosomes

7 0
2 years ago
Which table is correct about energy formation in plants?
erma4kov [3.2K]

Answer:

C

Explanation:

Photosynthesis the process where a plant makes energy to store it and use it and keep aking more to keep itself alive. C is the only one the says photosynthesis and has the right organs and products in the right spaces. The plants leaves are what make the energy. They need the sun (energy source) to make the sugars (energy product) that they need to survive.

8 0
3 years ago
over a period of years the average rainfall in an area has decreased causing environmental changes most likely to survive these
Irina18 [472]

a population of mealworms because they do not need water at all

4 0
3 years ago
an isolated colony on a selective medium is not considered a pure culture because inhibated organizms might be masked by the col
MArishka [77]

An isolated colony on a selective medium is not considered a pure culture because inhibited organisms might be masked by the colonies. This statement is true.

On the basis of their constitution or usage, culture media can be classified into various groups; these include defined, complex, selective, as well as enrichment medium.

A selective medium consists of dyes or noxious substances/chemicals which inhibit the growth of specific microorganisms but promote the growth of other microbes.

A pure culture is a laboratory culture which contains a single species of microorganism. It is free from other microorganisms.

Since selective media affects the growth of distinct organisms differently, therefore, an isolated colony formed in such type of medium is not considered a pure culture.

To learn more about pure culture here

brainly.com/question/21512552

#SPJ4

7 0
1 year ago
Other questions:
  • What produces variable traits depending on environmental conditions
    14·1 answer
  • Any statements about optimal population are inevitably culturally determined.
    7·1 answer
  • Which of these best explains why a molecule of ATP is needed for this type of transport?
    10·2 answers
  • All living things try to maintain a stable internal environment<br> known as
    12·1 answer
  • Organisms within each biome can be characterized by ______ that enable them to live and reproduce successfully in the environmen
    7·1 answer
  • Light is an example of what in an ecosystem?
    12·1 answer
  • After reviewing class material about the natural sources of drugs, the students demonstrate understanding of the material when t
    8·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Pls help!!!
    15·1 answer
  • Would a topographic map of a mountain today have the same appearance in the future?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!