Which one do you need help on
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
This part of the experiment serves as basis of comparison; the one variable being tested has been omitted Experimental group.This part of the experiment shows the effect of the one variable being tested.Independent variable.This variable is an experiment is the one being deliberately changed by the scientist.
<span>They are clones of the parent plant.!</span>
Because the organisms consume the departed
