1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rudiy27
3 years ago
14

Pls help me with this I would really appreciate it

Biology
1 answer:
guajiro [1.7K]3 years ago
3 0
Adenine always pairs with Thymine. (DNA)
Guanine always pairs with Cytosine.
(DNA)

*In the (RNA) Adenine pairs with Uracil (U).

-A and T
-C and G
-T and A
-G and C
-G and C
-G and C
-T and A
-A and T
-C and G
-T and A
You might be interested in
Electrons, protons, and neutrons are three subatomic particles of an atom. if the atom undergoes a change and becomes a positive
stepladder [879]
For an atom to become a positively charged ion it must lose negatively charged electrons.
8 0
3 years ago
Joint and bone pain, fever, weight loss, fatigue, weakness, hepatomegaly, splenomegaly and enlarged lymph glands are typical sym
kvasek [131]

Answer:

True.

Explanation:

White blood cells cannot function properly and their reduced production can lead to fever and frequent infections. This is because the function of white blood cells in fighting germs has been disrupted.

Other signs and symptoms:

- Weak and tired.

- Lack of appetite and weight loss.

- Swelling and bleeding gums.

- Headache.

- Abdominal swelling is caused by enlargement of the liver and lymph.

- Bone pain, can cause weakness.

Joint pain.

- The glands are swollen. If the glands in the neck and chest are swollen, it can cause blood flow to be blocked. This causes the face to swell, difficulty breathing and snoring.

#If i'm wrong, i'm sorry

4 0
2 years ago
What is the cytoplasm job in the factory?
Yakvenalex [24]

Answer:

factory floor!

Explanation:

function:

Contains the organelles; site of most cell activity.

6 0
2 years ago
Biomagnification occurs most commonly in which organisms
zavuch27 [327]
Large fish, carnivores, and birds of prey
5 0
3 years ago
Find the LCM of two numbers if there product is 160 and hcf is 4.​
suter [353]

Answer:

40

Explanation:

given

product of two numbers =160

hcf =4 we know that

hcf*LCM=product of the numbers

LCM*4=160

LCM=160/4

LCM=40

5 0
3 years ago
Other questions:
  • Where does mildew usually grow? Besides on clothes and wet/damp areas.
    10·1 answer
  • Which statement describes a shield volcano
    9·1 answer
  • Explain the process of buffering that occurs in oceans.
    5·2 answers
  • 2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
    14·1 answer
  • The dot plot shows the number of songs in a play list. Determine the mean of the data set. A) 39 B) 40 C) 41 D) 42
    15·2 answers
  • What is the scientific name for the layer of gas that surrounds the Earth?
    15·2 answers
  • Most genes have a dominant and recessive version called an
    11·1 answer
  • What are bio-fuels considered carbon neutral?
    11·2 answers
  • A paragraph on how selective breeding is better than cloning plz 100 POINTS
    14·1 answer
  • The four greenhouse gases that trap heat in the Earth's Atmosphere are Carbon Dioxide, Nitrous Oxide, Methane, and ___?​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!