1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Slav-nsk [51]
3 years ago
7

The nurse is caring for a client with giardia lamblia and anticipates that the provider will order what drug for the treatment o

f this client's diarrhea?
Biology
1 answer:
USPshnik [31]3 years ago
5 0
The answer to this question would be: <span>Nitazoxanide

</span><span>Nitazoxanide is a broad antiparasitic drug that can be used to treat infection of Giardia lamblia or Cryptosporidium parvum. It also a broad antiviral can be used for viral infection. 
Another drug that can be used for Giardia infection would be Metronidazole.</span>
You might be interested in
Will mark branliest
Sphinxa [80]
Your answer here is Commensalism by process of elimination
6 0
3 years ago
Read 2 more answers
How do decomposers increase the fertility of soil
Elanso [62]
Thy decompose dead organisms, and it turns into better soil.
5 0
2 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
What considerations do you need to make to ensure that your solution uses food that is most efficient for cellular respiration?
Slav-nsk [51]

For cellular respiration, the solution needs to be provided with glucose and optimum oxygen supply.

Explanation:

The cellular respiration uses the simplest form of food i.e. is glucose in its first step of glycolysis so, the food source must be in simpler form in the solution. Also, cellular respiration takes place in the presence of oxygen so optimum level of oxygen is to be supplied also temperature plays a key role so it also needs to be maintained.

6 0
2 years ago
We did not use a control group in this experiment. What is the purpose of the control group and how could we have set up with on
Dennis_Churaev [7]

Answer:

used in an experiment as a way to ensure that your experiment actually work

Explanation:

3 0
2 years ago
Other questions:
  • Which of these was not characterized of the first cells on Earth?
    8·1 answer
  • An age pyramid with a broad base that quickly slopes up to a narrow top would be indicative of ________.
    11·1 answer
  • What biome do palm trees live in?
    7·2 answers
  • Plants are designed to convert solar energy into usable chemical energy via the process of photosynthesis. As a result, plant ti
    11·2 answers
  • Help please!! (3 points)
    14·1 answer
  • HELP ME AGAIN PLZ I'M EXTRA STRUGGLIN ON THIS BIOLOGY
    6·1 answer
  • Tell chicken CAME first or egg with reason​
    15·2 answers
  • Do hummingbirds mate for life?
    7·2 answers
  • "At Jane's school, it was against the rules to have your phone on you. Phones were to be kept off and in your locker." Which wor
    10·2 answers
  • Why is fungi classified as neither a plant nor animal
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!