1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ivenika [448]
3 years ago
13

Solar panels convert light energy from sunlight into electrical energy. What material is most likely used in solar panels, and w

hy
Biology
2 answers:
inna [77]3 years ago
7 0

Answer: c. a metalloid is used because it is a semiconductor and can become more conductive when more light shines on it.

Explanation: i took the quiz.

Sever21 [200]3 years ago
6 0

Answer: Solar panels are made up of silicon cells. This because silicon has high ability for conduction and this make it to be able to convert sunlight into electricity. It is in solar cells has impurities and great chemical properties which make it to be to convert sunlight to electricity.

Silicon

Explanation:

Silicon is an element with atomic number 14, it is a non metal and crystalline solid. It has blue grey metallic lustre. Silicon is made with impurities in solar cells and has special chemical properties to convert sunlight into electricity. It is a semiconductor, a material that can act as a conductor and insulator.

When light interact with silicon cells, it make electrons to be in motion and initiate the flow of electricity, it is called photovoltaic effect.

Silicon alone is not used, it used with metal casing and wiring to ensure proper electric flow.

You might be interested in
The movement of sand from one place to another:
xxMikexx [17]

Answer:

the movement is called as saltation

Explanation:

hope it helps...

6 0
3 years ago
Read 2 more answers
*<br> Some eukaryotic cells and most prokaryotic cells contain
Dmitry_Shevchenko [17]

Answer:

plasma membrane, ribosomes...

Explanation:

Both prokaryotic and eukaryotic cells have structures in common. All cells have a plasma membrane, ribosomes, cytoplasm and DNA... The cytoplasm is all the contents of the cell inside the cell membrane, not including the nucleus.

6 0
3 years ago
How does the heart muscle differ from the muscle in your arm?
Diano4ka-milaya [45]

Answer:

While skeletal muscles are arranged in regular, parallel bundles, cardiac muscle connects at branching, irregular angles, called intercalated discs. Striated muscle contracts and relaxes in short, intense bursts, whereas smooth muscle sustains longer or even near-permanent contractions.

6 0
3 years ago
Read 2 more answers
Given two areas with equal sunlight and available water. Area I has a high amount of atmospheric carbon dioxide while Area II ha
Sindrei [870]

Answer:

(For USATestprep) C. The rate of photosynthesis increases with an increase in carbon dioxide.

Explanation:

Carbon dioxide is one of the reactants in the process of photosynthesis. The rate of photosynthesis increases with an increase in carbon dioxide.. If carbon dioxide is limited, then photosynthesis would slow down.

(Answer and explanation from USATestprep)

4 0
4 years ago
Compare how energy is used worldwide with how it is used in the United States.
Maslowich

Answer:

the U.S comsumes almost 15% of the worlds energy

Explanation:

yes

7 0
2 years ago
Other questions:
  • Where does meiosis take place in bryophytes
    15·1 answer
  • All of the types of rock make up the lithosphere except
    10·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What part of the human body is most similar in function to the spongy mesophyll layer in a leaf?
    5·1 answer
  • Which organism is most closely related to the house cat?
    5·1 answer
  • Explain the interaction between the gravitational pull of the sun and earths inertia
    15·1 answer
  • Please someone help me please
    13·1 answer
  • Why do you think it is important to protect against DNA damage sperm?​
    7·1 answer
  • What is the function of the phloem? Select one: Phloem carries water and minerals to the rest of the plant from the roots. Phloe
    14·1 answer
  • In your own words what is Adhesion water property
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!