1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
levacccp [35]
3 years ago
11

Transcription chain elongation is thought to generate ____ supercoils ahead of the transcription bubble and _____ supercoils beh

ind it. a. positive; negative b. negative; positive c. negative; negative d. positive; positive e. none of the above
Biology
1 answer:
frosja888 [35]3 years ago
6 0

Answer:

a. positive; negative

Explanation:

Transcription is the process of forming an RNA molecule from a DNA template molecule. In this process, the strands of DNA separate and one serves as a template for RNA, while the other is inactive. At the end of the transcript, the tapes that have been split back together again.

The transcription process is divided into three steps: initiation, stretching and termination

During the stretching phase, transcription chain elongation occurs. In this phase the enzyme called RNA polymerase starts to move through the DNA molecule, unwinding its helix and producing an increasingly lengthened RNA molecule. The already transcribed DNA is rewound almost immediately, recomposing its double helix. This process is called the elongation phase.

During this process, it is believed that positive supercoils  are generated ahead of the transcription bubble and  and the negative supercoils behind it.

You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
PLEASE HELP!!!!!
madreJ [45]

What is Mutualism ? Mutualism or symbiosis mean when two or more animal benefit to each other.like america red tail eagle and eagle, and the zebra and Oxpeckers eat ticks and other parasites that live on their skin of the zebra and the zebra will help the Oxpeckers by walking long place.

What is predation? predation or parasitic mean when animal who is prey eat not prey.or predation is when a animal hunt the other animal for food (prey).example like the lion eat the deer.

What is Competition? Competition or commensalism is when two animal fight for the same food like chipmunks vs squirrel, because the chipmunks like to eat nut and the squirrel eat nut they fight for the same resource.

7 0
3 years ago
Trapping has severely reduced the population of rabbits in an ecosystem, as shown in the bar graph below. What is the most likel
Romashka [77]

Answer:D

Explanation

took test

8 0
3 years ago
Improved bone regeneration through amniotic membrane loaded with buccal fat pad-derived MSCs as an adjuvant in maxillomandibular
muminat

Mesenchymal stem cells and HAM together may improve bone repair, especially in the horizontal dimension. Additionally, this technology lessens secondary bone resorption and the quantity of collected autogenous bone.

HAM:

  • Background: Human amniotic membranes (HAMs), a biological membrane with potential for cell therapy, osteogenesis, and healing, have come under the spotlight as a way to improve the results of treating bone abnormalities. The goal of the current study is to clinically evaluate the possibility of HAM loaded with stem cells from the buccal fat pad (BFSCs) as an osteogenic covering for only bone transplants to maxillomandibular bone lesions.
  • Materials and methods: The current investigation included nine patients with jaw bone abnormalities. Iliac crest bone graft with HAM covering (n = 5) and iliac bone grafts coated with HAM loaded with BFSCs (n = 4) were the two study groups that the patients were divided into. Cone beam computed tomography was carried out for radio morphometric characterization five months after the grafting and before the installation of the implant.
  • Results: The mean increase in bone width was found to be significantly greater in the HAM + BFSCs group (4.42 ± 1.03 mm versus3.07 ± 0.73 mm, p < 0.05). Further, the changes in vertical dimension were greater in the HAM + BFSCs group (4.66 ± 1.06mm versus 4.14 ± 1.03 mm, p > 0.05).

Learn more about  HAM here brainly.com/question/25199209

#SPJ4

7 0
2 years ago
State four cells that made up xylem<br>​
evablogger [386]

Answer:

The xylem consists of tracheary elements, xylem parenchyma cells, and xylem fiber cells.

3 0
3 years ago
Other questions:
  • The purpose of the menstrual cycle is to _____.
    14·1 answer
  • Must every living thing reproduce to prove that they are alive
    7·1 answer
  • How are the hours of darkness linked to the flowering time in plants?
    9·1 answer
  • "about how many calories are in one serving (14-17 grams) of alcohol?"
    15·1 answer
  • The amount of carbon dioxide in the atmosphere would greatly increase if they were fewer
    8·2 answers
  • For decades, people died from diseases we can now prevent through vaccination. Jenner is known for developing the first vaccine,
    15·1 answer
  • Deep sea corals can be hundreds or thousands of years old. Please select the best answer from the choices provided T F
    14·2 answers
  • PLEASE HELP SCIENCE PLEASE
    10·2 answers
  • True/False- A magnet can be strong enough to erase computer evidence.
    9·1 answer
  • Match the following terms and definitions.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!