Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end. 
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences. 
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted. 
I believe duplication is feasible since AATT sequences are repeated once. 
Our final answer,
 inversion and duplication occur here.
 
        
             
        
        
        
What is Mutualism ? Mutualism or symbiosis mean when two or more animal benefit to each other.like america red tail eagle and eagle, and the zebra and Oxpeckers eat ticks and other parasites that live on their skin of the zebra and the zebra will help the Oxpeckers by walking long place.
What is predation? predation or parasitic mean when animal who is prey eat not prey.or predation is when a animal hunt the other animal for food (prey).example like the lion eat the deer.
What is Competition? Competition or commensalism is when two animal fight for the same food like chipmunks vs squirrel, because the chipmunks like to eat nut and the squirrel eat nut they fight for the same resource.
 
        
             
        
        
        
        
Answer:
The xylem consists of tracheary elements, xylem parenchyma cells, and xylem fiber cells.