Answer:
Mutation is important as the first step of evolution because it creates a new DNA sequence for a particular gene, creating a new allele.
Explanation:
It's where Charles wrote his book
It is true that it is possible for a population to not evolve for a while.
There is something called the Hardy-Weinberg theorem, which characterizes the distributions of genotype frequencies in populations that are not evolving.
There are 5 Hardy-Weinberg assumptions:
- no mutation
- random mating
- no gene flow
- infinite population size
- and no selection (natural nor forced).
You can see that some of these are kinda extreme and really hard to get, but with approximations, we can work.
For example, instead of an "infinite population size" we have enough with a really large population, such that genetic drift is negligible.
Concluding, yes, it is possible (but really difficult) for a population to not evolve for a while (at least, in nature), as long as the 5 assumptions above are met.
If you want to learn more, you can read:
brainly.com/question/19431143
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
