1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DIA [1.3K]
3 years ago
7

Cuantos cromosomas tiene un búho

Biology
1 answer:
andrew11 [14]3 years ago
5 0
Tienen 26 cromosomas 
You might be interested in
Importance of respiration​
solmaris [256]

Answer:

Respiration is important because it converts food energy into chemical energy.

Explanation:

5 0
3 years ago
Data about our past climates is contained in...
ipn [44]

D. ice core samples for the arctic and anarctic

6 0
3 years ago
Read 2 more answers
All of the following are conditions that organisms in a tidepool must withstand except
NeX [460]
 d bc (a b c  and d) r the same to make a tidepool
3 0
3 years ago
How many grams of the compound in the figure above are required to make 1 liter of a 0.5 M solution? (Note: The atomic masses, i
Dafna1 [17]

Answer:

This question is incomplete as there is no figure in the question but the compound in the figure is Ethanoic acid (CH3COOH). Hence, we can calculate the mass.

The answer is: 30grams

Explanation:

According to the question, the volume of the compound (CH3COOH) is 1litre while the molar concentration is 0.5M

Molarity or Molar concentration is calculated using the formula:

M= n/V

Where; M= Molarity (M) = 0.5M

n= number of moles (mol)

V= Volume (V) = 1L

Hence, number of moles (n) = M × V

n = 0.5 × 1

n = 0.5 moles.

To calculate the mass in grams of CH3COOH, we say;

Number of moles (n) × molar mass (MM)

Since atomic mass for (C= 12, H= 1 and O=16)

Molar mass of CH3COOH:

= 12 + 1(3) + 12 + 16 + 16 + 1

Molar mass of CH3COOH = 60g/mol

Mass (in grams) of CH3COOH = 0.5 moles × 60g/mol

Mass = 30grams.

Therefore, 30grams of CH3COOH compound are required to make 1 liter of a 0.5 M solution.

6 0
3 years ago
Which is most likely to change with new discoveries and technologies
pishuonlain [190]
<h2>Answer:</h2>

A) classification of organisms

<h2>Explanation:</h2>

With the advancement of technology, many plants and animal were re-classified and reversed. For instance due to the advanced light microscope, which had high resolution and magnification, scientists were able to identify the structure of many organisms on a highly molecular level. Whitaker was a biologist who distinguished that fungi was separate from plants because fungi doesn’t have chlorophyll. Similarly there are so many evidences that resulted in the re-classification of organisms.

6 0
2 years ago
Read 2 more answers
Other questions:
  • The gd mat on the fur of the bats should be expected to consist of _____.
    5·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • A satellite in space experiences direct sunlight and heats up. During periods when it receives no direct sunlight, (1 point) PLE
    6·2 answers
  • Question 7 (1 point)<br> glucose + fructose -&gt; sucrose + water is a type of<br> reaction
    10·1 answer
  • Mary is twenty-two weeks pregnant, and her fetus has an X and a Y chromosome. Mary is having a a0.
    9·1 answer
  • A comparison of the three different forms of double-stranded DNA reveals that _____ has the largest pitch per turn of the helix,
    14·1 answer
  • Polysaccharides are made of?
    5·2 answers
  • What evidence supports Hess's theory of seafloor spreading?
    8·1 answer
  • Carbohydrates are a huge source of...
    11·1 answer
  • Which of the
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!