1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saw5 [17]
3 years ago
13

What is the correct order of development in sexual reproduction?

Biology
1 answer:
SVETLANKA909090 [29]3 years ago
4 0

answer

Explanation:

The stages of fertilization can be divided into four processes: 1) sperm preparation, 2) sperm-egg recognition and binding, 3) sperm-egg fusion and 4) fusion of sperm and egg pronuclei and activation of the zygote.

You might be interested in
She always prepared food.(Yes/No question)​
Maurinko [17]

Answer:

<h3>Yes</h3>

She always prepared food.

7 0
2 years ago
If the pride is taken over by new individuals what happens to the female ?
Step2247 [10]

Explanation:

Pride is the social community of lions where they grow, mate, reproduce, communicate, hunt etc. When male lions gets control of a new territory or a pride, they most of the times kill the cubs of the pride because they are not biologically related and do not want to waste their energy by ensuring that the cubs genes are passed on.

They don't want to be stepfathers. Female lions also will not be responsive to mating during the time they are feeding, so killing the cubs allows the male lions to reproduce.

3 0
3 years ago
Read 2 more answers
What is the best description of what viruses are made of?
Mazyrski [523]

The answer is C.

A virus is made up of or consists of a nucleic acid in varying quantity which may either be RNA or DNA.

The nucleic acid is surrounded by a protein shell called a capsid. The word capsid comes from the Latin word  capsa which means box.The capsid and the nucleic acid within it are together referred to as nucleoprotein.The  capsid is made up of small sub units called capsomeres.

In many viruses, the nucleoprotein makes up the whole virus. More complex viruses have one or more further enclosing structures also made mostly of protein. These structures are referred to as envelopes and each envelop is specific to a particular virus. 



6 0
3 years ago
Read 2 more answers
The three major components of connective tissue are.
stiv31 [10]

Answer:

1. specialized cells

2. extracellular protein fibers

3. a fluid known as ground substance

Explanation:

5 0
2 years ago
TO INVESTIGATE AND COMPARE THE MOVEMENT OF TWO NAMED JOINTS IN THE HUMAN BODY
WINSTONCH [101]

Answer:

tendons and knees

Explanation:

the tendons are in the fingers, and they move to allow various actions such as holding things. the knees, allow us to walk, and join the forelegs and legs. their movement is different and they allow various actions, however, both are important.

8 0
3 years ago
Other questions:
  • Which of the following is false?
    7·2 answers
  • What is the minimum number of nanocontainers that a person would need in their bloodstream to provide 1 hour's worth of oxygen?
    11·1 answer
  • Marble is a _____ metamorphic rock. banded foliated nonfoliated folded
    13·2 answers
  • In the cells of the human body, oxygen molecules are used directly in a process that (1) releases energy (2) digests fats (3) sy
    9·1 answer
  • What is meant by the following statement about the cell membrane?
    5·2 answers
  • Which of the following does not belong to the domain Archaea?
    12·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Bacteria were first observed in 1903. True False
    10·1 answer
  • A commercial rancher that raises and sells cattle wants to expand her business by increasing the size of her herd from 1,000 cow
    8·2 answers
  • Which of these is a product of cellular respiration:
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!