1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lana66690 [7]
4 years ago
6

How did Darwin’s time as the HMS Beagle’s naturalist lead to his theory of Evolution?

Biology
1 answer:
vovangra [49]4 years ago
7 0

Darwin’s time as the HMS Beagle’s naturalist lead to his theory of Evolution by all of the above given statements.

Answer: Option D

<u>Explanation:</u>

During the voyage of Beagle’s Darwin was a naturalist. He observes many plants, animals, collect specimens of animals, plants, fossils. During the voyage he visited place like Galapagos, Callao-lima, Bahia, Rio-de Jeneiro, Montevideo, Falkland Islands, Cape Town, Cocos Island, and Hobart etc.

During this journey he observes the tropical rain-forest where new inhabitants (plants and animals) are found having different behavior. He also dug some fossils and compares them animal in earth surface and he found they are alike and their structure changes over certain time. After analyzing all these fact, he proposed ‘Theory of Evolution'.

You might be interested in
Unlike saltwater, freshwater _________.
expeople1 [14]
Is needed to keep most plants alive
8 0
4 years ago
Read 2 more answers
The three animals are a turtle, a mouse, and a bat. Answer the questions below or give me starters/ examples on how I should ans
Gennadij [26K]

Answer:

the questions are basically telling you to look at the diagrams you have about the animals and asking for observations you can make about them

Explanation:

4 0
3 years ago
Because the genetic backgrounds of _____________ twins are identical, researchers can conclude that variations in their behavior
Kitty [74]

Answer:

Monozygotic

Explanation:

Monozygotic twins are formed by fertilization of single sperm and single egg but during cleavage process they separate out and serve as individual organisms. After their birth, environmental factors may influence variation in their behavior even though they were identical clones of each other. Thus, it may conclude that, environmental factors may influence variation among monozygotic twins.        

4 0
3 years ago
Why the answer is B???
Anit [1.1K]
Cause it is the only place that water can run threw
5 0
3 years ago
Read 2 more answers
Will a ball move faster if it is kicked hard or rolled gently? Explain.
NNADVOKAT [17]

Answer:

Explanation:The ball would roll slowly if rolled gently. So if you kick the ball hard the impact of your foot. Will make the ball move faster.

3 0
3 years ago
Other questions:
  • The right answer is glass paper and plastic
    14·2 answers
  • 50POINTS
    15·2 answers
  • Heat is a byproduct of muscle activity. This heat allows
    6·2 answers
  • Describe the similar services provided by banks and credit unions. How do these two institutions differ in their philosophy and
    11·1 answer
  • What two features are first seen in the marine worms
    12·1 answer
  • ______________ break down essential nutrients and return them to the soil.
    10·2 answers
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Help me fill me fill in the blanks please???
    7·1 answer
  • Hjgvfyufy7uf7y6fy67ufuy
    11·1 answer
  • (FOR BRIANLIEST!!!) PLEASE HELP ILL LOVE YOU 4L))
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!