What would happen if the parent cell were to divide more times than usual during mitosis

1 answer:

5 0

These cells grow, and then divide to form a total of four cells. Those four cells grow and divide to form eight cells, etc. B) In meiosis, a single cell divides twice, resulting in four daughter cells that do not grow and divide again. Instead, these cells are modified to become eggs or sperm in humans

You might be interested in

Water that is fit to drink is called?

ivanzaharov [21]

Water that is fit to drink is called?

<u>A- Potable </u>

B- Fluoridated

C- Non Bacterial

D- Saline

4 0

3 years ago

Read 2 more answers

What is exine is made up of????

Solnce55 [7]

Answer:

sporopollenin

While the exine is composed of sporopollenin, a complex and highly resistant biopolymer containing fatty acids, phenylpropanoids, phenolics and carotenoids, the intine is largely composed of pectin and cellulose.

Explanation:

6 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Does nonpolar mean hydrophobic or hydrophilic

Lesechka [4]

no hydrophobic and hydrophilic refer to phospholipids in the cells membrane. A nonpolar molecule is a molecule which has no separation of charge, so no positive or negative poles are formed. In other words, the electrical charges of nonpolar molecules are evenly distributed across the molecule.

4 0

3 years ago

HELP FAST ASAP PLEASE

zzz [600]

The answer would be letter a

4 0

3 years ago