1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kkurt [141]
3 years ago
10

What did scientific investigations on sudbury's soil reveal

Biology
1 answer:
mel-nik [20]3 years ago
4 0
Scientific investigations on Sudbury's soil revealed the decrease
in soil pH was correlated with increased copper and nickel levels.
You might be interested in
How can immunizations prevent certain diseases?
adell [148]

People used vaccines to reduce the risk of infection by working with body as defenses to help them so this vaccines develop immunity to disease


I hope that's help:0

5 0
3 years ago
Which component in a graph indicates an independent factor?
castortr0y [4]
On a bar graph, the x axis represents the independent variable and the y axis the dependent variable. 


3 0
3 years ago
Why is glucose converted to ATP if they are both energy?
Crank
Glucose is converted into ATP because it is usable energy. Glucose is stored energy
5 0
4 years ago
Which famous scientist is credited as the founder of the scientific method? Aristotle John Dalton Sir Francis Bacon Sir Isaac Ne
Brut [27]
<span>The option C is actually Roger Bacon not Francis Bacon who promoted and started the scientific method.</span>
8 0
3 years ago
Read 2 more answers
Experiments on the positive phototropic response of plants indicate that ______. A. light destroys auxin B. auxin moves down the
artcher [175]

The answer is auxin can move to the shady side of the stem.

Phototropism is a reaction to environmental factors. It is a plant's response to sunlight in the form of movement. In plants, phototropism is very prevalent. In actuality, it is necessary for plant growth. Other plant movements also occur in response to touch, water, gravity, and other factors. Phototropism was discovered due to well-known experiments by Charles Darwin and Boysen Jensen.

There are two types of phototropism:

  • Positive phototropism
  • Negative phototropism.

Learn more about auxin here:-

brainly.com/question/16939476?referrer=searchResults

#SPJ4

8 0
1 year ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • The ability of your body's immune system to distinguish between your cells
    13·1 answer
  • This aquarium exhibits biotic and abiotic factors in an aquatic environment. One of the abiotic factors isA) coral.
    14·1 answer
  • What 3 currents are formed in the beach?
    15·1 answer
  • Based on his experiments, Mendel concluded that each trait was controlled by two _____.
    14·2 answers
  • Which statement best describes the role of gene expression in cells?
    11·2 answers
  • An object with a mass of 2.0 kg has a force of 4.0 Newtons applied to it. What is the resulting acceleration of the object?
    11·1 answer
  • A person would never have pure water put into their veins in a hospital because their cells would what?
    7·1 answer
  • PLEASE HELP!!
    9·1 answer
  • A 15-yr-old girl had a seizure this morning and was rushed to the hospital. On examination, her temperature is 40C and she had n
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!