1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tino4ka555 [31]
3 years ago
15

Popular culture may include changing trends in all of the following categories except

Biology
2 answers:
vazorg [7]3 years ago
5 0

Answer:

b

Explanation:

on e d g e n u i t y

MrRissso [65]3 years ago
4 0
History is the answer. Art, music and clothing are all trends where history is not
You might be interested in
A mutation that results in a single amino acid substitution in Ras abolishes its ability to hydrolyze GTP, even when GTPase-acti
Drupady [299]

Answer:

The new drug will not be effective against the treatment of cancer.

Explanation:

The drug will not be effective against the cancer treatment because the drug will inhibit the dimerization of receptor tyrosine kinase (RTK) but as the Ras has undergone mutation due to replacement of one amino acid, it will be constitutively expressed and the drug is not effective in stopping the Ras functioning.

Thus, Gefitinib cannot work against the cancerous cell as it is not potent to stop the functioning of mutant Ras protein.

7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Hello can someone help me please and thank:)
denpristay [2]

Answer:

B- J, L, K

Explanation:

Wrong Subject but the largest side's opposite angle is the largest if that made sense. For example, KL which is the largest side corresponds to the largest angle <J.

7 0
2 years ago
How thick is the exosphere?
steposvetlana [31]
<span>The exosphere is the fifth and final layer of the atmosphere. This layer is a little thicker than the theremosphere at 500-1000 km thick.</span>
8 0
3 years ago
Two people are exercising at a gym. Person X notices a burning sensation in several muscles, while person Y does not feel any di
Alex Ar [27]

Answer:

See the answer below

Explanation:

Person X is feeling a burning sensation in several muscles<u> because of the accumulation of lactic acid due to inadequate oxygen in their system.</u> When oxygen becomes inadequate during exercises, anaerobic respiration takes place to augment the oxygen shortage and this leads to the production of lactic acid which accumulates up in the muscles and gives a burning sensation.

  C_6H_1_2O_6 --> 2C_3H_6O_3

Person Y does not feel any burning sensation in their muscles <u>because oxygen is adequate in their system and they do not need to respire anaerobically.</u> <em>Person X exercise regime must have been more rigorous than that of person Y.</em>

5 0
3 years ago
Other questions:
  • In healthcare settings where sterilization is an absolute necessity what method of sterilization will typically be used?
    14·1 answer
  • It's an emergency<br><br>the theme reads<br>the importance of vegetables for our diet ...​
    5·1 answer
  • Which of the following would be a result of eutrophication of nitrogen?
    12·2 answers
  • The first land plants relied on _________ for fertilization.
    14·1 answer
  • How does the cell membrane help maintain the homeostasis of water content?
    7·1 answer
  • I need help with this quick plz
    7·1 answer
  • Which of the following is a chemical change that occurs to the food?
    10·1 answer
  • Is there an advantage for the different
    7·1 answer
  • Which type of bone injury result from the tearing of a ligament in a form of a sprain?
    9·1 answer
  • Amniocentesis chorionic villus sampling, and multiple marker screening provide important information about the health of the let
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!