1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tino4ka555 [31]
2 years ago
15

Popular culture may include changing trends in all of the following categories except

Biology
2 answers:
vazorg [7]2 years ago
5 0

Answer:

b

Explanation:

on e d g e n u i t y

MrRissso [65]2 years ago
4 0
History is the answer. Art, music and clothing are all trends where history is not
You might be interested in
What decomposes animals in a rainforest?
Crazy boy [7]

Answer:

things such as termites, slugs, scorpions, worms, and fungi

6 0
3 years ago
A similarity between mitosis and meiosis is that each start with a cell that has:
Oduvanchick [21]

Answer:

46

Explanation:

in mitosis it doubles to 92

6 0
1 year ago
Which bone is identified in the picture below?
arlik [135]

Answer:

errrrrrrrrrrr

Explanation:

4 0
3 years ago
Read 2 more answers
Explain ATP in detail
Naddika [18.5K]

Answer:

Adenosine triphosphate, also known as ATP, is a molecule that carries energy within cells. It is the main energy currency of the cell, and it is an end product of the processes of photophosphorylation (adding a phosphate group to a molecule using energy from light), cellular respiration, and fermentation.

It is made up of the molecule adenosine (which itself is made up of adenine and a ribose sugar) and three phosphate groups. It is soluble in water and has a high energy content due to having two phosphoanhydride bonds connecting the three phosphate groups

 Its main function is to store energy within the cell. ... ATP hydrolysis is an exotermic reaction, releasing energy which is used by the cell.sphate groups.

6 0
2 years ago
Read 2 more answers
Why does individual commit crime?​
saw5 [17]

People commit crimes for many different reasons. whether it is for the excitment and thrill of it or whether they were forced to or peer preasured on by another person. Maybe they robbed a bank cause they needed money or they were under the influence of drugs or alchohol

7 0
3 years ago
Read 2 more answers
Other questions:
  • Most states consider a BAC of _____, or greater, legal intoxication. This number is actually much lower for teenagers
    5·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which one of the following is a difference between a normal cell and a cancer cell?
    11·2 answers
  • Can we survive without endoplasmic reticulum in our cells? Explain your answer.
    6·1 answer
  • Within each eon, identify major events and the types of life that dominated the Earth during the time.​
    11·1 answer
  • Producers transform light energy into chemical energy. True or false
    7·1 answer
  • Anyone got that bud h m u
    5·1 answer
  • PLEASE HELP ASAP!!!!
    5·1 answer
  • Contrapposto is defined as:
    15·1 answer
  • Easter Island is described as having a mild climate and fertile soil, which should be favorable for a diversity of organisms. Wh
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!