1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ratling [72]
4 years ago
7

true or false cells in the same organism differentiate Because they have a different set of DNA than the other cells

Biology
2 answers:
sammy [17]4 years ago
8 0
False, because cells in the same organism don’t differentiate because they have all the same set of DNA than all the other cells.
serious [3.7K]4 years ago
5 0

Answer:    False.

Explanation:   Cells in the same organism don’t differentiate because they have all the same set of DNA than all the other cells.

Hope this helps

Please give me Brainliest

You might be interested in
Pseudomonas syringae strain Lz4W is a Gram-negative, Antarctic soil species that grows at 0ºC. This strain has been used to det
marin [14]

Answer:

A. The RNA polymerase subunits of the P.syringae strain probably have extra flexibility so that they can move more freely in colder temperatures.

Explanation:

Because there is no difference in the amount of the RNA polymerases but rather their activity, the difference lies in their structure and not their sequence. Hence the answer can't be (B) or (D). Adaptations are made to broaden the conditions of survival. Hence E. coli would not limit it's survival by limiting its growth to warmer temperatures. Hence the answer is (A) the RNA polymerase subunits of the P. syringae strain probably have extra flexibility so that they can move more freely in colder temperatures.

4 0
4 years ago
Read 2 more answers
can you predict the properties of a compound by knowing the properties of the elements that make up the compound?
MakcuM [25]
No, you cannot determine the properties of a chemical compound by solely knowing the properties of the elements that make up the compound, because in a chemical compound, the properties are completely different and or independent of the chemical and or physical properties of the individual elements used to make up the compound.
3 0
3 years ago
Each replication fork requires both leading and lagging strand synthesis. Why?
svet-max [94.6K]

Answer:

Because each strand acts as a template for the synthesis of a new, complementary strand.

Explanation:

This is known as semiconservative DNA replication. Leading and lagging strands are complementary, antiparallel strands (one is 3'-5' while other is 5'-3- direction) which are replicated differently. The leading strand is replicated  continuously while the lagging strand is replicated in fragments-Okazaki fragments. Replication of both strands is performed by DNA polymerase.

5 0
3 years ago
A.
larisa86 [58]

Answer:

C

Explanation:

Experiments can be done to prove whether it is true or not.

5 0
4 years ago
2. These molecules capture energy from the sun during cellular respiration and
Angelina_Jolie [31]

Answer:

B

Explanation:

your answer is chlorophyll 100% positive

5 0
3 years ago
Other questions:
  • What is NOT an example of an ecosystem?
    9·1 answer
  • What is mostly the reason of an organism having lipids in its body
    15·1 answer
  • Which organism might be at the top of the food chain in a deciduous forest?
    9·1 answer
  • What is inside the flower and can you describe it pls oh and don’t mind squid -ward ???
    15·2 answers
  • The bubonic plague, also called the Black Death, killed about 200 million people in the 1300s. The disease is caused by a bacter
    13·2 answers
  • Which of the following statements is true about the taiga biome, but not the alpine
    13·1 answer
  • What is one way in which the agriculture industry can prevent both erosion and nutrient loss from soil?
    11·1 answer
  • Why cant chloroplasts and mitochondria live outside the cell now?
    11·1 answer
  • Why do skin cells grow back when skin cells get damaged
    14·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!