Answer:I think that answer is b
Explanation:
Protein-energy malnutrition is a form of undernutrition caused by an extremely deficient intake of calories, protein, or both. Two examples of this type of malnutrition are kwashiokor and marasmus. Protein-energy malnutrition is more often caused by decreased absorption or abnormal metabolism. It is defined as a range of pathological conditions arising from coincident lack of protein and/or energy in varying proportions. The condition vary in forms ranging from mild through moderate to severe degrees.
Answer:
A or C
Explanation:
Xylem consists of several different types of <u>cells</u>: fibers for support, parenchyma for storage, and tracheary elements for the transport of water. The tracheary elements are arranged as<u> long tubes through which columns of water are raised</u>. In a tree trunk, the innermost part of the wood is dead but structurally strong xylem, while the outer part consists of living xylem, and beyond it, layers of cambium and phloem.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
The amount of solar radiation that reaches any one spot on the Earth's surface varies according to: Local weather. Because the Earth is round, the sun strikes the surface at different angles, ranging from 0° (just above the horizon) to 90° (directly overhead).
Explanation:
hoped this helped! <3 A brainiest is always appreciated! if this helped give a thanks and rating, i always try to reply to comments! have a nice day :)
