Answer:
ATGGCCTACGGTCTAGTTTAG
Explanation:
A=T
C=G
G=C
T=A
This is the key to finding a complementary <u>DNA strand</u>.
B. Both processes form woven bone.
Explanation:
Bone growth and development is mainly characterized by bone ossification processes taking place through the two main osteogenic pathways – intramembranous and endochondral ossification.
The woven bones are the primary immature bones formed by both these ossification processes from the bone cells (osteoclasts, osteocytes, osteoblast) and calcified bone matrix. These woven cells later developed into the mature secondary bones or the lamellar bones – spongy (cancellous) or compact (dense cortical) bones.
Intramembranous ossification takes place mesenchymal sheets of connective tissues and produces soft spongy bones.
Endochondral ossification results in replacement of hyaline cartilage to form the long bones.
Answer: The advantages of spines in these unrelated organisms are as follows:
- for escape and defence
- for regulations of body temperature
- for conservation of water
Explanation:
The evolution of spines in Tenrecs, echidnas and hedgehogs represent STRUCTURAL ADAPTATION i.e when a part of the body of a living organism undergoes changes to become structurally adapted to its mode of life.
- The evolved spines in hedgehogs are for physical defence
- in tenrecs, they are for physical defense
his efforts to fight oppression without violence
Evolution is a broader use of language terminology. Biological evolution refers to the evolvement of a particular biological species such as an animal or a plant. On the other hand evolution can refer to the evolution of anything. There are no constraints on what it is being preferred to.
Please vote my answer brainliest! Thanks.
