The polypeptide chain will be six amino acids long after mutation has occurred on the mRNA strand.
Explanation:
The mRNA sequence to be transcribed into the polypeptide chain
5’AUGACCCAUUGGUCUCGUUGGCUGAAGUCA 3’
If hydroxylamine were applied to cells and caused mutation changing G to A at position 20. It will lead to a change in the amino acid to be produced and also a change in the expected number of amino acids.
Thus, if we have: 5’AUGACCCAUUGGUCUCGUU<u>G</u>GCUGAAGUCA 3’
A change from G to A will change the triplet codon to UAG which is one of the three stop codons signifying the end of translation, thus there will be six amino acids formed.
Enzymes are regulated by more than the binding of small molecules. A second method that is used all the time by eucaryotic cells to regulate a protein's function is the covalent addition of a phosphate group to one of its amino acid side chains. These phosphorylation events can affect the protein in two important ways.
The reactions of cellular respiration can be grouped into three stages: glycolysis, the Krebs cycle (also called the citric acid cycle), and electron transport.