1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tatiana [17]
3 years ago
6

What organism can ferment lactose but can't use citric acid for all their carbon needs

Biology
1 answer:
aleksklad [387]3 years ago
4 0
I think it is carbohydrate metabolism

You might be interested in
An example of natural selection is the tail of a male peacock. The females of the species choose mates based on the colors of th
Lera25 [3.4K]
Since the means of reproduction have changed, the population of peacocks would probably start losing their pretty feather colors due to the fact that over time females would be mating with the containing the other trait (and possibly not the pretty feathers). This would then produce offspring with ugly colors but also with the desired trait. This would continue on and on until those with the desired trait outnumbered or possibly extinguished the now unnecessary vibrant feather colors.
4 0
3 years ago
Read 2 more answers
Cells that support neurons structurally and functionally are called B NEUROGLIA
Alex787 [66]

Answer:

B. neuroglia.

Explanation:

Neuroglia, also called glial cells are cells that support neurons structurally and functionally.

There exists two broad classes of cells in the nervous system which are:

  1. Neurons
  2. Glia

The neurons process information while the glia support the neuron mechanically and metabolically.

In general, there are three main types of cells that make up the nervous system including the above two.

3 0
3 years ago
1. Which image represents the flow of a longshore current in relation to a sandy beach?​
Dimas [21]

Answer: Option C

Explanation:

When waves of water approach the beach, they do so as an angle because they have been slowed down by the first parts of the beach that they have encountered.

When they hit the beach at an angle, they come back to the water and keep doing so like the movement shown in option D. This constant motion moves the sand and other particles on the beach progressively and the current that does so is the Longshore current which <em>moves parallel</em> to the coastline.  

4 0
2 years ago
The spinal cord has input and output connections to the rest of the body via the _____ nervous system.
Kazeer [188]
The central nervous system is what connects your spinal cord to your brain and the rest of your body.
6 0
3 years ago
A star is born whenever a nebula expands.
arlik [135]
A star is born whenever a nebula expands.
This is false.

A star is born when another star gets old from the remains of that a new star is born. <span />
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Endergonic reactions ____.
    13·1 answer
  • The movement of glucose into cells via glucose transporter proteins is an example of
    13·1 answer
  • What do plants use light absorbing molecules called pigments for
    12·1 answer
  • 3. How do osteoclasts break down the bone?
    6·1 answer
  • Where does the cellular respiration occur in the biosphere
    10·2 answers
  • HELP!!! ME PLEASE!!!!!!​
    15·1 answer
  • What is a positive outcome of extinction? What is a negative outcome of extinction?
    10·1 answer
  • Help i need this its timed
    11·1 answer
  • Gene expression from the lac operon can be controlled in many ways, including a robust negative regulation strategy. Select muta
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!