1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
castortr0y [4]
3 years ago
8

Name Three main biomes in the United States

Biology
1 answer:
kompoz [17]3 years ago
8 0

Arctic & Alpine Tundra. Coniferous Forest (Taiga)

Tundra Biome. Alpine tundra in the Rocky Mountains of Colorado.

Coniferous Forest Biome.

You might be interested in
A scientist makes the argument that two species of butterflies should be considered the same species because they have similar D
MakcuM [25]

Answer:

butterflies have different mating seasons

Explanation:

1:they have to have similar structre both internally and general appearance just like us and apes same genus different species

3: migration could vary with the habitat like lack of food in an area could lead them to migrate earlier or later

4:colour variation can also vary because of habitat since some may be darker to camouflage cause of predators like an adaptation.

7 0
2 years ago
Read 2 more answers
(5.01 MC)Which of the following abiotic factors affects the ocean by providing substances that an organism obtains from its envi
kipiarov [429]

Answer:

d. Nutrients

Explanation:

took the test

3 0
3 years ago
Danny has a long history of alcohol abuse. he prefers whiskey and drinks it daily. when he was jailed for several days after an
rewona [7]

The answer is withdrawal symptom. This is caused by the abrupt discontinuation or decrease in intake of medications or recreational drugs, in this case, alcohol. It begins with substance dependence where the body of the subject adapts to a state of repeated alcohol administration. WIthdrawal offsets the body of its balance hence cravings and withdrawal symptoms.






7 0
3 years ago
Read 2 more answers
RNA has a different nitrogenous base. This" different" base pairs with Adenine meaning RNA base pairs are represented ( A-U &amp
iren2701 [21]

Answer:

Uracil

Explanation:

DNA only uses Thymine so that leaves Uracil for RNA because all of the other bases are used for both.

5 0
3 years ago
Read 2 more answers
Which cranial bone can be seen laterally, inferiorly, superiorly when the skullcap is off, and through the orbits of the eye?
telo118 [61]

The sphenoid bone.

Though double check

6 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What process exerts the pull on water molecules that is relayed from leaf to root via cohesion?
    9·2 answers
  • Which cells of bones secrete the matrix of Haversian canal?
    7·1 answer
  • Where does the energy come from to add a uracil to the 3' end of a transcript?
    7·1 answer
  • Explain the importance of independent and dependent variables in an experiment.
    8·2 answers
  • Equilibrium is best defined as a state of _____
    14·2 answers
  • Why do you need a minimum of three Seismic stations to determine the location of an epicenter
    9·1 answer
  • Evaluate the pros and cons of using an NPK fertilizer, a natural compost, and lime on a field with substantial amounts of clay a
    5·1 answer
  • Why do living things undergo meiosis?
    8·2 answers
  • Label the angle of incidence and the angle of reflection in the Figure below.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!