1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Scorpion4ik [409]
3 years ago
7

It is on the picture so can you plz answer it

Mathematics
1 answer:
matrenka [14]3 years ago
4 0

the answer is C. Expanding Gases :D

You might be interested in
Sam counted out loud by 6s . Jorge counted out loud by 8s. What are the first three numbers both Sam and Jorge said
mart [117]
6, 12, 18, 24.

8, 16, 24.

24 is your answer. Hoped I helped!
6 0
3 years ago
Read 2 more answers
-3x-3y=3 and y=5x-17
Vesna [10]
The answer for this question is "y = -5/3 and x = 8/3"
5 0
4 years ago
Pls help me solve this
NISA [10]

Answer:

$50

Step-by-step explanation:

12 x 30 = 360

960 - 360 = 600

600/12 = 50

3 0
3 years ago
Read 2 more answers
Please need answer help help?!?!?
hjlf

Answer:

5

Step-by-step explanation:

5 0
3 years ago
Read 2 more answers
A relation is plotted as a linear function on the coordinate plane starting at point C (0,−1)(0,−1) and ending at point D (2,−11
Alika [10]
To find the rate of change, or slope, pick two points. The slope, is change in y coordinates over change in x coordinates.
slope =  \frac{y2-y1}{x2-x1}.

In this case, the slope is 
\frac{-11+1}{2-0} =  \frac{-10}{2} = -5.
Remember that subtracting a negative number equals adding the number without the negative sign.
a-(-b) = a+b

Now for the y-intercept. The y-intercept is where the graph intersects the y-axis, where x = 0.
You have the coordinate (0, -1), where x = 0. So the y-intercept is -1.

Putting these values into the slope-intercept form y = mx+b, the equation is
y = -5x - 1
4 0
3 years ago
Other questions:
  • There are 8 juice boxes in the refrigerator. Each box holds cup of juice. How many cups of juice are in the refrigerator? A stud
    9·2 answers
  • What is the probability that a random permutation of the letters in MATHEMATICS contains the word TEA (with those three letters
    13·1 answer
  • 19 is 20%of what number
    9·1 answer
  • Greta is opening a savings account. She starts with $100 and plans to add $59 each week. Write an equation she can use to calcul
    12·1 answer
  • Expanded form 403,892
    14·2 answers
  • Use the quotient rule to find the derivative of the given function.
    11·1 answer
  • jocelyn is playing a game she gains 4 points, looses 8 points, and gains 3 points.what is her final score?
    12·1 answer
  • Give the values of a, b, and c needed to write the equation's standard form. (5 + x)(5 - x) = 7
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Mrs. Yang is in charge of playing the music while her class plays musical chairs. In the first round, Mrs. Yang played the music
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!