Because these non native species can cause competition for the same food source as the native species thus making it harder for the native species to survive. Also the non native species could see the native species as food causing them to die out. As well as introducing new diseases that these native species don’t know how to defend themselves from
Answer:a. Draw Punnett squares for each couple (you may need to do more than 1 square/ couple)
Baby 2 MUST belong to the Browns because Mr. Brown is the only parent with an A allele to
contribute… then the rest works out as follows:
b. To which parents does baby #1 belong? Why? Hint you may want to refer to your Punnett
squares.
Baby 1 must belong to the Smiths, because they are the only ones with the possibility of EACH
having a recessive allele to pass down to the baby, Mr. Brown has type AB blood and therefore
only has the dominant A and dominant B alleles – no recessive allele possible.
Explanation:
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
The scientific investigation is the systematic approach of the scientists to answer the questions about the world. It is applied almost all of the theories including the Theory of Natural Selection. Darwin's theory of evolution is a result of scientific investigation. In this theory, they investigate by observing the distribution of species.
