1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
denis23 [38]
4 years ago
14

Which of the following disorders results from changes in an individual gene?

Biology
2 answers:
adoni [48]4 years ago
6 0
I'm pretty sure the answer is: B. Sickle-cell disease
SCORPION-xisa [38]4 years ago
5 0
Hi your answer is gonna be b.
You might be interested in
Which of the following is not a possible consequence of surface mining?
aleksklad [387]

Answer;

B. improved ecosystem health

Explanation;

-Surface mining is a method of extracting minerals near the surface of the Earth. The three most common types of surface mining are open-pit mining, strip mining, and quarrying.

-The environmental impact of mining includes erosion, formation of sinkholes, loss of biodiversity, and contamination of soil, groundwater, and surface water by chemicals from mining processes.The environmental effects of surface mining include;

  • Habitat destruction
  • Soil erosion
  • Air pollution from dust particulates
  • Pollution (especially from sediments)
  • All surface mining techniques negatively affect the environment, though some methods are more damaging than others.
7 0
4 years ago
Read 2 more answers
What are Examples of real life cell membraine
Novosadov [1.4K]

Answer:

brain to human

Explanation:

hope this helps

3 0
3 years ago
To reduce erosion On steep slopes people can A plant vegetation B insert drainage C build walls D all of the above ?
Mariana [72]
The correct answer is D. "All of the Above."
5 0
4 years ago
Read 2 more answers
The figure below shows bands of DNA that were separated using gel electrophoresis. Which band contains the smallest DNA fragment
diamong [38]
I believe the answer would be Band C.
6 0
3 years ago
Which exercise should be avoided if a client exhibits anterior pelvic tilt?
saw5 [17]
Anterior pelvic tilt leads to poor posture which increases the risk of knee pain, lower back pain/injuries, and other musculoskeletal disorders. It is a posture problem that affects almost anyone who sits a lot. If a client exhibits this disorder then the exercise of Calf raises should be avoided. Calf raises are methods of exercising the gastrocnemius, tibialis posterior and soleus muscles of the lower leg.
6 0
4 years ago
Other questions:
  • What are covalent bonds???
    14·2 answers
  • Which assessment is most supportive of the nursing diagnosis, impaired skin integrity related to purulent inflammation of dermal
    10·1 answer
  • In November 2004 the floodgates of Glen canyon Dam opened in attempt to improve the Colorado river habitat .The release topped 1
    12·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Which of the following would cause an error in DNA replication?
    13·1 answer
  • What refers to any instrument or weapon used in a death, such as a knife or firearm?
    11·1 answer
  • What is the difference between populations and communities?
    7·1 answer
  • Describe in detail how a heterotrophic organism makes energy available for cellular processes.
    5·1 answer
  • Why do cells need to regulate what goes in and out of them?
    6·1 answer
  • An earthquake’s magnitude is a measure of the _____.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!