1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
saw5 [17]
3 years ago
6

The atoms found in living tissues all have complete outer electron shells and are therefore quite stable on their own.

Biology
1 answer:
nataly862011 [7]3 years ago
3 0
What is your question?

You might be interested in
23. Where is the warm sector located in reference to a developed mid-latitude cyclone over the United States? a. To the north c.
zaharov [31]

The jet stream brings down colder air from the north into the southern regions of the United States so B . southeast I think.

4 0
3 years ago
Read 2 more answers
Recall that DNA is
Mashutka [201]

Answer:

25 nucleotide sequence pair

Explanation:

There are four nucleotide sequence pair present in DNA. and if we have 100 nucleotide so 25 nucleotide sequence pairs will be formed and each pair contains adenine (A), cytosine (C), guanine (G), and thymine (T).

Cytosine nucleotide paired with guanine nucleotide and Adenine nucleotide paired with thymine nucleotide . They have hydrogen bonds between each bases.  

6 0
3 years ago
The first protists probably appeared around a. 1.5 million years ago b. 170 million years ago c. 1.5 billion years ago d. 5 bill
mixer [17]

Answer:

1.5 billion years ago

Explanation:

Protists are a collection formed up of protozoa, unicellular algae, and fungus forms. We will focus on the being part of this society: the protozoa (proto = first, zoa = beings). Protozoa are the earliest discovered collection of heterotrophic living that utilize and modify complicated meal particles into power. Although protozoans are only made up of a single cell, these organisms control to perform all the necessary responsibilities of life.  The protozoa are split into four principal associations: the ciliates, the flagellates, the heliozoans, and the amoebas.

7 0
3 years ago
Read 2 more answers
What are the cons of urbanization?
DaniilM [7]

Answer:

Land Insecurity

Very Poor Living Conditions

Unemployment

Crime.

To name a few

4 0
3 years ago
Read 2 more answers
Which of these is not a process that can cause speciation?
Igoryamba
The answer is C because it’s something that can be caused by speciation, not can cause it
8 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which factor will most likely reduce the carrying capacity of a squirrel population in a forest?
    14·1 answer
  • Brown eyes is dominant to light eyes. Mr.O'Ryan has blue (light) eyes. Mrs.O'Ryan is heterozygous for brown eyes. What are the c
    11·1 answer
  • Weather occurs in Earth's troposphere, which is _____________
    5·2 answers
  • How do cells get ATP, the energy currency that does work in living things? It evolves via chemical evolution.
    6·1 answer
  • Which chordate structures are lost when the larval tunicate developes into the adult form ?
    6·1 answer
  • Question 3 of 10
    10·1 answer
  • Structure and Properties of Matter:Question 4
    15·1 answer
  • What does it mean when we say water utilities "treat" water?​
    6·2 answers
  • A protein that functions as a biological catalyst is called:.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!