1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mars2501 [29]
3 years ago
5

How did Mendel's experimental methods help him develop his hypotheses on inheritance?

Biology
1 answer:
Jlenok [28]3 years ago
4 0

Answer:

by seeing the results of his experiments

Explanation:

You might be interested in
List the 6 levels of organization from smallest to largest
arsen [322]
<span>Individual, Population, Community, Ecosystem, Biome, and Biosphere</span>
5 0
3 years ago
PLEASE ANSWER!!!
Goryan [66]
Species and genus. hope that helps
6 0
3 years ago
What type of plant drops its leaves annually in response to approaching winter?
Alekssandra [29.7K]
<span>They are called conifers or Coniferophyta</span>
4 0
3 years ago
Which student's classification correctly separates organisms into these two kingdoms?
Kitty [74]

Student 3 correctly separate organisms into these 2 kingdoms

8 0
3 years ago
Select the correct answer from each drop-down menu.
julia-pushkina [17]

Scientists obtain a great deal of the evidence they use by observing natural ... The shift developed from the assumption that a scientific theory is a system of ... If observational evidence is objective in this sense , it can provide peopl

6 0
3 years ago
Other questions:
  • It's A right??? I'm like 10000000% positive it is..
    8·2 answers
  • Making Comparisons Read the description of how
    12·1 answer
  • Which of the following statements about DNA and nucleic acids is TRUE? Please choose the correct answer from the following choic
    15·1 answer
  • Adult skin cells can no longer become other types of cells because they have already undergone
    15·1 answer
  • Which one of the following conditions is an example of resource partitioning?
    7·1 answer
  • The water hyacinth is an invasive species that can spread extremely fast, blanketing a water surface in a very short period of t
    14·1 answer
  • What will be the result of photosystem 2 being exposed to less sunlight?
    13·1 answer
  • Why are there are more substances on earth than are listed on the periodic table of elements
    12·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • If there is 8 g of a substance before a physical change, how much will there be afferwards
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!