4 years ago

Aubrey played on the playground for 2 1/2 hours. How many minutes did she play?

Mathematics

2 answers:

Mashutka [201]4 years ago

8 0

150 minutes (2.5 x 60 = 150)
Answer: 150

marshall27 [118]4 years ago

5 0

Aubrey plays for 150 minutes on the playground.

You might be interested in

What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA

Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0

3 years ago

Read 2 more answers

What is the next number 2 3 5 7 11 13 17?

sammy [17]

<span>19, 23, 29, 31, 37, 41, 43 are the numbers, i believe</span>

3 0

4 years ago

Read 2 more answers

HELP PRECALC NEED IN PROOF FORM

Vinil7 [7]

Hello, please consider the following.

We know the following, right ?

$(\forall a, b \in \mathbb{R}) \left( sin(a+b)=sin(a)sin(b)+cos(a)cos(b) \right)$

So, here, it gives.

$Asin(\omega t+\phi)=Asin(\phi){\sf \bf sin(\omega t)}+Acos(\phi){\sf \bf cos(\omega t)}\\\\=c_2{\sf \bf sin(\omega t)}+c_1{\sf \bf cos(\omega t)}\\\\\text{ *** where }c_2=Asin(\phi) \text{ and } c_1=Acos(\phi) \text{ ***}$

Do not hesitate if you need further explanation.

5 0

4 years ago

Find the mode for the set of data. 70, 80, 50, 30, 40, 50, 90, 80, 50

m_a_m_a [10]

The mode is 50 because it occurs the most frequently (three times) out of any of the values.

5 0

3 years ago

Will is packing cubes with side lengths that are

fgiga [73]

Answer:

Step-by-step explanation:4545

5 0

3 years ago

Read 2 more answers