1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Montano1993 [528]
3 years ago
11

Two structures play an important role in the way that birds digest food.

Biology
1 answer:
jolli1 [7]3 years ago
7 0

Answer:

Gizzard and crop

Explanation:

I just answered that question.

You might be interested in
Plant cells make their own food by taking in<br>​
aniked [119]

Answer: Sunlight.

Explanation: They use photosynthesis to absorb the sunlight.

5 0
3 years ago
Read 2 more answers
A 75-year-old man, Patrick R., presented to the emergency room with fever, shortness of breath, chest pain, and severe, extremel
kvv77 [185]

Answer:

Explanation:

cough or expectoration Breathing may be assisted by pursed lips and use of accessory respiratory muscles; patients may adopt the tripod sitting position The chest may be hyperresonant.

coughing can also cause Presentation Symptoms sudden-onset, unilateral, pleuritic chest pain dyspnea acute respiratory distress Physical exam decreased or absent breath sounds hyperresonance

appearances may be normal Sweating, tachypnoea, tachycardia (most common finding) Splinting of the chest wall to relieve pleuritic pain Decreased or absent breath sounds Hyperresonance

3 0
3 years ago
Living things have basic needs that must be met to survive and grow. Which needs are illustrated in the picture? Check all that
avanturin [10]
Food, a place to live, air, water
5 0
3 years ago
Read 2 more answers
What difference do you see between ribose and deoxyribose sugars?
abruzzese [7]

Answer:

ribonucleic acid, a nucleic acid present in all living cells. Its principal role is to act as a messenger carrying instructions from DNA for controlling the synthesis of proteins, although in some viruses RNA rather than DNA carries the genetic information.

Explanatioim smart now give brainliest plz

6 0
3 years ago
Read 2 more answers
Create a sentence explaining how animo acids from proteins
Bumek [7]
<h2>Answer:</h2>

<em><u>Amino acids are joined together by peptide bonds, in which the amino or NH2 of one amino acid bonds to the carboxyl (acid) or COOH group of another amino acid to form Proteins.</u></em>

8 0
3 years ago
Read 2 more answers
Other questions:
  • What is the name of the enzyme that breaks down protein
    11·1 answer
  • Unlike bacterial genes, genes in eukaryal cells do not contain consensus promoter regions.
    14·1 answer
  • A common concern for beer brewers making sour beers is contamination from Acetobacter. This organism converts ethanol to acetic
    5·2 answers
  • Name two stages that are involved in producing proteins
    7·1 answer
  • When an animal changes its colors to adapt to its environment this is called what​
    13·1 answer
  • When was the term acid rain first used?<br><br> 1960<br><br> 1753<br><br> 1980<br><br> 1852
    11·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • Explain why SARS-COV-2 is classed as a pathogen
    12·1 answer
  • Un ratón A de pelo blanco se cruza con uno de pelo negro y toda la descendencia obtenida es de pelo blanco. Otro ratón B también
    7·1 answer
  • A brown coat is dominant to a white coat in cattle. A farmer has a brown bull. How would you determine whether the bull is a het
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!