1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NeX [460]
3 years ago
14

Describe The Climate Of Mount Kilimanjaro

Geography
1 answer:
GarryVolchara [31]3 years ago
5 0
Mt Kilimanjaro can create its own climate due to how high it is, but most of the the temperatures are in the negatives.
You might be interested in
Need answer asap pls someone help​
olganol [36]
The answer is B. 181
3 0
3 years ago
Area A is located close to a volcanic vent, but area B is far away. What is the expected distribution of iron ore deposits in ea
SCORPION-xisa [38]

Area A will have higher iron ore deposits than area B.

6 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
State three factors to consider when citing a weather station​
Delicious77 [7]

Answer:

wind, air temperature,and water vapour pressure

3 0
3 years ago
At a minimum, how many seismic stations are necessary to locate the epicenter of an earthquake?
Effectus [21]

Answer: To locate the epicenter of an earthquake, scientists must have seismograms from at least three seismic stations.

Explanation: I hope this helps:)

3 0
3 years ago
Other questions:
  • What is the perimeter of ABC with vertices at A(-11,4),B(-7,8),and c(-4,4)? Round only your final awnser to the nearest tenth
    8·1 answer
  • 2041-02-01-02-00_files/i0260000.jpg
    6·1 answer
  • The lithosphere floats on the asthenosphere like glass on clay. When the clay moves, the glass moves. The movement of the lithos
    6·1 answer
  • What percent of 88 is 38? if necessary, round to the nearest tenth of a percent.
    15·1 answer
  • Why do contour lines never cross on a topographic map?
    14·1 answer
  • Please help edementum
    5·1 answer
  • Where was Mesopotamia? along the Tigris and Euphrates Rivers along the Nile River along the Mediterranean Sea along the Red Sea
    12·1 answer
  • Since 1880 how many degrees hotter has the Earth been?
    15·1 answer
  • Why is Venus the planet of beauty, love, and luxury?.
    11·1 answer
  • The great barrier reef is located in ________. question 2 options: fiji marshall island australia new zealand
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!