Two major pieces of information can be determined from analyzing a karyotype of an unborn child

Biology

1 answer:

OLEGan [10]3 years ago

3 0

Answer:

i need points sorry

Explanation:

You might be interested in

Please answer me in struggling so much with this

Burka [1]

Answer:

The answer is 42

trust me its 42

3 0

3 years ago

Explain in detail the life cycle of the metamorphosis of amphibians.

ANTONII [103]

Answer:

Amphibians begin their lives as eggs, The few eggs that get fertilized, and survive will hatch in 7-9 days. After the eggs of an Amphibian hatch they are called Tadpoles. Tadpoles breathe through gills like fish. ... Metamorphosis is the final process that changes the amphibian from tadpole to adult.

Explanation:

1. I studies this in 7th grade and remeber every single bit of it (monte vista)

2. Google

6 0

3 years ago

Which of the following will best be demonstrated with a submentovertex (full basal) projection of the skull?A. OrbitsB. Mandible

bonufazy [111]

Answer:

The answer is C.

Explanation:

The submentovertex or the full basal projection of the skull is used best to demonstrate the base of the skull or the base of cranium. In this method, the x-rays' direction is starting from under the chin and exiting at the vertex or the top of the skull.

I hope this answer helps.

3 0

3 years ago

Read 2 more answers

What part of the cell cycle is represented by the picture labeled as steps 2-4?

Umnica [9.8K]

Answer:

Does your bio textbook show you?

4 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago