1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snezhnost [94]
3 years ago
6

Which of the following is an example of organic matter?

Biology
2 answers:
Luden [163]3 years ago
8 0
I think the answer would be sugar because because it is a plant residue and has the components of what makes an example of organic matter
n200080 [17]3 years ago
5 0

Answer:sugar

Explanation:

You might be interested in
How many genes code for hemoglobin?
Pepsi [2]

Answer:

Four

Explanation:

Like all proteins, the "blueprint" for hemoglobin exists in DNA.

3 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
A. What is the diploid number of the species shown in Figure 1?
Sloan [31]

Answer:

I hope this helps you

Explanation:

1)This number is abbreviated as 2n where n stands for the number of chromosomes. For humans, the diploid chromosome number equation is 2n = 46 because humans have two sets of 23 chromosomes (22 sets of two autosomal or non-sex chromosomes and one set of two sex chromosomes).

2)Under normal conditions, the haploid number is exactly half the total number of chromosomes present in the organism's somatic cells. For diploid organisms, the monoploid number and haploid number are equal; in humans, both are equal to 23.

7 0
3 years ago
Which of these characteristics is common only at the embryonic stage of fish and humans, and is suggestive of a common ancestor
Yakvenalex [24]

Answer:

C) Presence of gill slits

Explanation:

Please don't confuse yourself with the other answer.. the correct answer (as verified by USATestPrep) is C) Presence of gill slits.

Good Luck,

x Barbie

4 0
3 years ago
Read 2 more answers
The sporophyte of an unknown plant species grows as a separate plant than the gametophyte. The plant produces both female and fl
coldgirl [10]

Answer:

Hi how are you doing today Jasmine

3 0
3 years ago
Other questions:
  • What compounds are the building blocks of DNA macromolecules?
    10·1 answer
  • Weather conditions all over the world during an El Niño year is unusual. Many rain clouds forms over this warm part of the Pacif
    14·2 answers
  • Which are the first organisms to start the process of primary succession? A. woody shrubs B. microorganisms C. grass species D.
    7·2 answers
  • What part of plant has eggs in ovule
    7·1 answer
  • I need help!!! Please!!!!!
    10·1 answer
  • a freshman injures the left ventral root of his first thoracic vertavra when he falls of a fire engin ladder what major functin
    8·1 answer
  • Please help<br>will give the brainliest!<br>Urgent!!!​
    6·2 answers
  • Can someone help me with this? If the answer is correct ill mark it as the best answer!
    8·1 answer
  • Which is a reactant in the Calvin cycle?
    14·2 answers
  • Could we find anything else than bacteria? What would that be? Why?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!