1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vesna [10]
2 years ago
10

How much of the solar energy that enters the Earth's atmosphere actually reaches the earths surface

Biology
1 answer:
Aleksandr [31]2 years ago
6 0

Answer:

51% is absorbed by earth

You might be interested in
Which modern day organism has the most exponential eyesight in the animal kingdom?
Juli2301 [7.4K]

Answer:

b

Explanation:

becuse

8 0
3 years ago
Read 2 more answers
Data must be considered valid for scientists to trust conclusions. which is the best way to increase the validity of data in an
ddd [48]
The best way to increase validity of data in an experiment is by performing the experiment numerous times and obtaining measurements and data upon each run of the experiment.
8 0
3 years ago
Read 2 more answers
Kangaroos that nurse their young in a pouch are what type of mammal?
gogolik [260]

Answer:

Marsupials

Explanation:

Marsupials, or pouched mammals, are a group of animals that includes kangaroos and koalas. ... Most marsupial babies crawl into a pouch on their mother's belly.

7 0
3 years ago
sunflower and paddy trees are flowering plants. state one equation and three differences between the two plants.
Zina [86]
Sunflowers grow on a large stalk, and often only produce one flower. paddy plants produce many small flowers, with heavy pollen.
3 0
3 years ago
What is a stem cell​
Natali5045456 [20]

Answer:

Stem cells are special human cells that have the ability to develop into many different cell types, from muscle cells to brain cells. In some cases, they also have the ability to repair damaged tissues.

Explanation:

4 0
2 years ago
Other questions:
  • This fallacy occurs when there is an error in inductive or deductive reasoning.
    5·1 answer
  • What are two ways in which a particle that is too large to fit through the cell membrane can enter the cell?
    8·1 answer
  • A 23-year-old computer programmer comes to the office for an annual examination. She has recently become sexually active and wan
    14·1 answer
  • Why is delayed implantation an advantageous adaptation for the European roe deer
    10·1 answer
  • What is the type of subunits that form amylase
    12·1 answer
  • The phylum Cycliophora was discovered in 1995. They are tiny organisms that live in large numbers on the outsides of the mouthpa
    11·1 answer
  • What occurs during a solar eclipse? Select two options.
    13·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • Is this the right answer or should I flip the answers?<br> Help!!!
    15·2 answers
  • rections: bw that you have Identified the different animals that can be raised as an alternative source of come for the family,
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!