1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nirvana33 [79]
3 years ago
11

The basic types of tissue in the human body are

Biology
1 answer:
poizon [28]3 years ago
7 0

Answer:

The basic types of tissue in the human body are...

1. Muscle

2. Epithelial

3. Connective

4. Nervous

Explanation:

There are only 4 types of basic tissue in the human body. However there are many more tissues in your body.

Please mark brainliest and have a great day!

You might be interested in
Are used for main source of energy
DaniilM [7]

Answer:

you meant what are the main sources

they are: fossil

clean energy

energy storage

hydrogen& fuel

electric power

3 0
4 years ago
Which of the following is NOT true about enzymes?
8090 [49]

changes shape after the reaction is not true

5 0
3 years ago
Where are most of the ATP molecules produced in aerobic respiration?
aev [14]

Answer:

I think the correct answer is D.

8 0
3 years ago
What are the major nonrenewable and renewable sources of energy?
quester [9]

Answer:

1). Renewable energy resources include: solar, wind, water (hydro), biomass, and

2). Nonrenewable energy resources include: coal, nuclear, oil, and natural gas.

Explanation:

Renewable energy resources are replenished naturally and over relatively short periods of time while Nonrenewable energy resources as their name applies are limited in their quantity and supplies too.

These forms of energy are primary formed when fossil fuels are destroyed by use, i.e they are not been recovered(nonrenewables); which brings in alternative sources(renewables).

Human supplies of fossil fuels and minerals are dwindled fast. These are nonrenewable resources as we cannot produce them by any process. Our demand for these limited resources, however, is constantly increasing. So we to cut down their wastages, find acceptable alternatives and also recycle them where possible.

7 0
3 years ago
Read 2 more answers
The ratio between the force of sliding friction and the normal force of an object is called​
morpeh [17]
The coefficient of friction
8 0
3 years ago
Other questions:
  • How is a climax community different than a primitive community?
    6·2 answers
  • Scientists want to determine how closely related chimpanzees are to humans. Which data would give the MOST accurate comparison?
    10·2 answers
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • It is true that epidural bleeding is a. associated with widespread vascular disruption. b. characterized by a lucid interval imm
    11·1 answer
  • Place the steps of photosynthesis into the correct order from top to bottom.
    14·1 answer
  • Help me, please with this :)
    11·1 answer
  • The chromosomes of eukaryotic cells are found in the
    12·1 answer
  • Why is weather important in sustaining life on the planet?
    7·2 answers
  • Which of the following is an example of natural selection?
    8·1 answer
  • Which food idem contains a lot of proceeded simple sugars?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!