What absorbs most of the energy that is radiated from Earths Surface?

1 answer:

5 0

The process by which gases hold heat in the air. The greenhouse effect is a natural process that keeps Earth's atmosphere at a temperature that is comfortable formost living things. What absorbs most of the energy that is radiated from Earth's surface? water vapor, carbon dioxide, methane, and other gases.

You might be interested in

If the frequency of a dominant allele in a population in equilibrium is 0.35, then the frequency of the corresponding recessive

Nadusha1986 [10]

Answer:0.8775

Explanation:formula for gene frequency is p+q=1

where p is the dominant allele and q is the recess allele.

Given than p=0.35

P^2=0.35^2=0.1225

q=1-p

q=1-0.1225=0.8775

Answer is 0.8775

3 0

3 years ago

Elaina has been diagnosed with a small brain tumor. She first went to see her doctor after experiencing symptoms such as feeling

stellarik [79]

Answer:

B. Hypothalamus

Explanation:

Hypothalamus controls all the aforementioned functions. A tumor caused a reduces functionality

8 0

2 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved