1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gulaghasi [49]
3 years ago
6

The following models show one large cell (A) and four small cells (B).

Biology
2 answers:
Fudgin [204]3 years ago
6 0
B is better because it has more surface area.
ZanzabumX [31]3 years ago
6 0

The surface area to volume ratio is a critical factor in deciding the ability of a cell to take in the nutrients through a passive transport process like diffusion. When the surface area to volume ratio is high, diffusion becomes the best way to take in the nutrients without the expense of energy. When the surface area to volume ratio is low, the cell requires active processes like presence of specialized transport proteins and cytoskeleton to take in the nutrients. In the two models, model A has a lower surface area to volume ratio (\frac{6 \times a^2}{a^3}) while the model B has a greater surface area to volume ratio (\frac{(6+2) \times a^2}{a^3}, when the two inner surfaces are included). Hence model B will have better movement of nutrients through diffusion than model A.

A.  B is better because it has more surface area.

You might be interested in
Please answer all questions and explain if you can. thank you.
lawyer [7]
1 a............................
7 0
3 years ago
What is the primary role of most forensic scientists?
KATRIN_1 [288]

Answer:

D.

to analyze evidence

Explanation:

took test

6 0
2 years ago
Read 2 more answers
Some insects can walk on the surface of water. Which behavior of water is responsible for this phenomenon?
tatuchka [14]
There are some insects that can walk on water, this phenomenon is possible because the water has surface tension. One animal that can walk on water is the lizard. 
4 0
3 years ago
Read 2 more answers
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Cellular respiration is a process involving the breakdown of glucose molecules in order to generate energy for cellular activiti
djverab [1.8K]
The products are H2O and CO2 which then become the reactants for photosynthesis
6 0
3 years ago
Read 2 more answers
Other questions:
  • Which pharmacokinetic parameter is affected most by decreased intestinal motility related to the aging process? a. excretion b.
    15·1 answer
  • BRAINLIEST!! Would the mass of the light bulb change as it travels from Earth to the Moon. Why or why not? please explain in a c
    6·2 answers
  • Can someone please write a 250-word essay about one of these systems
    8·1 answer
  • Most radially symmetric animals are aquatic.
    11·1 answer
  • Is a vacuole found in a plant or animal cell​
    6·2 answers
  • Levels of biodiversity
    7·1 answer
  • Help me with biology
    8·1 answer
  • What is not a dissolved gas present in the ocean
    12·2 answers
  • Explain why a hydrocarbon like benzene can enter the skin with little difficulty and is dangerous inside the body, but an acid l
    15·1 answer
  • The tRNA with the anticodon CGC should have linked at its 3 'terminal to the amino acid:
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!