1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Snowcat [4.5K]
4 years ago
6

4. Who would you expect to be most at risk for developing the bone disease rickets?

Biology
1 answer:
nataly862011 [7]4 years ago
8 0

Answer:

a.) Children born to mothers with dark skin, living far from the equator.

Explanation:

You might be interested in
Which best explains how heat plays a role in the movement of materials within Earth’s interior?
Temka [501]

Answer: Convection

Explanation: Cold water sinks because it is more dense than warm water.

Warm water rises because it is less dense than cold water.

7 0
4 years ago
Please help, Giving Brainliest!!!!!
ArbitrLikvidat [17]

Answer:

C) genetic variation

Explanation:

The answer C is correct because genetic variation is the differences in DNA amongst species in a population. All these dog breeds have their distinct features because their DNA aren't all the same, like how some have big curly hair or short hair.

Have a lovely rest of your day/night, and good luck with your assignments! ♡

5 0
2 years ago
Read 2 more answers
If a parent cell has 18 chromosomes, each daughter cell following meiosis II will have ________ chromosomes
bogdanovich [222]

Meiosis II will have 18 chromosomes.

Meiosis:

  • Somatic cells divide during meiosis, a process in which the genetic makeup or quantity of chromosomes in the daughter cells is maintained.
  • In sexually reproducing organisms, a kind of cell division known as meiosis results in a decrease in the number of chromosomes in gametes (the sex cells, or egg and sperm). Human body cells, also known as somatic cells, have two sets of chromosomes and are diploid (one from each parent).
  • A single cell splits twice during the meiosis process, resulting in four cells with half the original genetic material. These cells—sperm in men and eggs in women—are our sex cells.

Learn more about meiosis here brainly.com/question/16249478

#SPJ4

7 0
2 years ago
How do decomposers in an ecosystem obtain energy?
OLga [1]
Decomposers don't obtain energy, they release it into the environment.
hope this helps.
6 0
3 years ago
Which is an example of respiration?
insens350 [35]

Answer:

I believe its D.

Explanation:

Respiration is an carbon releasing posses.

5 0
3 years ago
Read 2 more answers
Other questions:
  • Are biotic dangerous if yes how<br><br> Please help
    15·1 answer
  • What is homozygous ?
    15·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • How does convection occur in the troposphere?
    12·2 answers
  • Which one of the following best explains the pathological mechanism in malignant melanoma?
    10·1 answer
  • Morphine is considered a(n) ________ drug because it decreases pain.
    6·2 answers
  • NEED HELP! EXTRA POINTS!!!
    8·1 answer
  • What is the maximum number of atoms that a hydrogen atom can bond with in an organic compound?
    7·1 answer
  • Please hurry!!
    8·1 answer
  • Need help with my work that all
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!