1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anon25 [30]
4 years ago
14

Cells _________ in order to create cells that perform specific functions.

Biology
2 answers:
Anna [14]4 years ago
6 0

Cells differentiate in order to create cells that perform specific functions.

schepotkina [342]4 years ago
3 0
Cells DIFFERENTIATE in order to create cells that perform specific functions.
You might be interested in
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
The largest bone of the upper arm, extending from the elbow to the shoulder, is the ________________.
Rasek [7]
I think the answer is humerus
8 0
3 years ago
What technology is allowing astronomers to study these phenomena such as star explosions, neutron stars, and black holes
Vanyuwa [196]

Phenomena such as star explosions, neutron stars, black holes etc. are studied with the help of extremely powerful and sensitive telescopes.

These sophisticated instruments are able to see more than our own eyes can. Thus, they detect wavelengths outside of those found in our visible spectrum, such as X-rays etc.

The most sophisticated telescopes are those that are placed in space such as the Hubble or Spitzer Space Telescope. In this way, these instruments are able to circumvent the Earth's atmosphere that may block the view of the sky. Thus, in space, they have the optimal conditions to observe and study in detail such phenomena.

8 0
3 years ago
Imagen a disease that kill 50% of cockroaches in population. will this affect birth rate?
Harman [31]
Yes because more of them are gone
5 0
3 years ago
An organism is found that has the following traits produces seeds has a vascular system multicellular what kingdom does this org
vfiekz [6]
I would guess the plant kingdom, as it produces seeds. The vascular system indicates that they are large plants (trees). Because of the large body, trees has a vascular system so it can transport water and nutritients throughout the body. 
8 0
3 years ago
Read 2 more answers
Other questions:
  • how does the introduction of a non-native top predator species, such as a python, affecting the flow of energy in the florida ev
    8·1 answer
  • Deficits in visual spatial skills and fluent language skills are found in which genetic syndrome?
    5·1 answer
  • Describe two biologically important features of diffusion
    7·1 answer
  • What is not true of combustion reactions
    15·1 answer
  • During replication,<br>are responsible for joining the nucleotides of a new DNA strand together.​
    8·1 answer
  • One way that fossils form by the dead organism's soft tissue is ________ by sediments such as sand.
    7·1 answer
  • Which is the best example you of a direct observation
    13·1 answer
  • 4) This is the removal of trees and the conversion of forest lands to farmlands, logged areas, or cities.
    9·1 answer
  • Which statement about ATP and energy is true?
    13·2 answers
  • What is the mechanism(s) that bordetella pertussis uses to invade epithelial cells in the lungs?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!