1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
avanturin [10]
3 years ago
8

Genotype refers to the trait seen such as the color white in fur color while phenotype refers to the alleles Bb for a heterozygo

us dominant fur color. A)True B)False
Biology
1 answer:
DaniilM [7]3 years ago
8 0

False.

The genotype refers to an allele, such has Bb.

A phenotype is a physical trait, such as white furm

You might be interested in
The bedrock of the adirondack mountains was formed mainly by the
MatroZZZ [7]
There are choices for this question namely:

a. cementation of clastic sediments and precipitates from seawater 
<span>b. compaction and recrystallization of volcanic material </span>
<span>c. regional metamorphism of sedimentary and igneous rocks </span>
<span>d. contact metamorphism of unconsolidated gravel 
</span>
The correct answer is that the bedrock of the Adirondock mountains is formed mainly by regional metamorphism of sedimentary and igneous rocks. The geology of the Adirondock mountains formed around 5 million years ago with rocks  over 1000 million years old. At this very ancient age, the sedimentary and igneous rocks in the Adirondock mountains have undergone extensive heat and pressure hence regional metamorphism of the existing sedimentary and igneous rocks.
7 0
3 years ago
Arthur reads an article describing an experiment to test the effects of caffeine on the reaction time of humans—how long it took
AlladinOne [14]
B. The change in Reaction times for each person
8 0
3 years ago
lots of points Viruses and bacteria can infect human cells. Bacteria are living organisms, while viruses are not. How do you thi
timofeeve [1]

Answer:

I did not understand questions

5 0
3 years ago
Whats the Location and the Structure for prestsynaptic membrane
Sergeeva-Olga [200]

Answer:

The presynaptic membrane is formed by the part of the presynaptic axon terminal forming the synapse and that of the postsynaptic neuron is called the postsynaptic membrane. The space between the presynaptic and postsynaptic membrane is called the synaptic cleft. These three structures together form the synapse.

Explanation:

5 0
3 years ago
Humans can respire aerobically and anaerobically. Which are products of both aerobic cell respiration and anaerobic cell respira
Yakvenalex [24]
Humans can respire aerobically and anaerobically. Pyruvate and ATP are products both aerobic cell respiration and anaerobic cell respiration in Humans. 
4 0
4 years ago
Other questions:
  • Which theory sounds like an explanation that Lamarck might give
    6·1 answer
  • What is the main skeletal difference between salt water eels and lamprey fish besides the jaw
    9·1 answer
  • PLEASE HELP!!
    12·2 answers
  • The diagram below shows the skeletal forearms of different species. Although the functions are different what evidence of evolut
    12·1 answer
  • In order to avoid confusing entomology (the study of insects) with etymology (the study of the history of words), Vicky associat
    9·1 answer
  • How does the structure of DNA allow it to complete the process of replication?
    6·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • 10. When fertilization occurs, the resulting zygote is a diploid cell containing two of every type of chromosome. This is becaus
    5·1 answer
  • True or False - A compound that is being oxidized loses at least one electron,
    14·1 answer
  • Students set up a controlled experiment by growing the same type of seedlings in two different locations. After a period of time
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!