Consider these questions when deciding what kingdom each species belongs to:
Is it single or multi-celled?
Can it move?
Does it make its own food?
Does it have a nucleus in its cell(s)?
What is the species capable of?
Passive transport ,As it goes from higher concentration to lower concentrations
The probe would need to bind to the site
<span>TTTTAGCCATTTACGATTAATCG
The sites that are bold are were the probe need to bind in order to target the DNA. The sequence of the prob needs a site that is </span><span>complementary and antiparallel to it.</span>
Answer:found on the surface of erythrocytes.
Explanation:
Rhesus (Rh) factor is an inherited protein found on the surface of red blood cells. If your blood has the protein, you're Rh positive. If your blood lacks the protein, you're Rhnegative. Rh positive is the most common blood type
The answer to the question is b
