1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Agata [3.3K]
3 years ago
10

How many electrons are in an atom of zirconium?

Biology
1 answer:
SSSSS [86.1K]3 years ago
7 0

Answer:

There are 40 electrons and protons and 50 neutrons

Explanation:

You might be interested in
In which two ways can scientists exhibit ethical behavior?
alexdok [17]
Number 5 would be the best awnser.
As a scientist who remains impartial can more accurately conclude his data while doing experiments.
3 0
3 years ago
Read 2 more answers
Who invented bifocal eyeglasses and a clean-burning stove, and helped develop the U.S. postal system?
viva [34]

Answer:

Benjamin Franklin

Explanation:

Benjamin Franklin was one of the founding fathers of America and he is well known for his many inventions as well. All the mentioned inventions were invented by him along with his contribution towards development of U.S Postal system.

4 0
3 years ago
Will give Brainliest answer
tigry1 [53]
The answer is choice a.
4 0
3 years ago
Read 2 more answers
Studying habitats and how they are affected
Fynjy0 [20]
It falls under ecology.
6 0
3 years ago
A man is brachydactylous (very short fingers; rare autosomal dominant), and his wife is not. Both can taste the chemical phenylt
netineya [11]

Answer:

The correct answer is -

A) BbTt x bbTt

B) .5^4 or 1/16 or 0.0625

Explanation:

As it is given that Brachydactylus and PTC tasters both traits are autosomal dominant conditions which mean only one allele would be enough.

For Branchydactylus and For tasting :  man and women will be heterogeneous.

Hence,

The Genotype of man = BbTt

The Genotype of wife = bbTt

b. Answer = 0.0625

For Branchydactylus:

Bb X bb

Possible genotypes:

B b

b Bb( Brachydactylus) bb(normal)

b Bb (Brachydactylus) bb (normal)

The probability of a single child being Branchydactylus = 2/4 = 0.5

So,  Probability of all 4 child being Branchydactylus = .5 x .5 x .5 x .5 = 0.0625

3 0
3 years ago
Other questions:
  • Match each scenario with the correct component of natural selection
    11·1 answer
  • *PLEASE HELP*
    15·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What treats the body using principles similar to acupuncture and acupressure?
    13·1 answer
  • The two most common factors that influence enzymatic activity are ____.
    8·1 answer
  • The nerves that are responsible for converting tactile stimuli into electrical signals that the brain can understand are called
    12·1 answer
  • Can you count how old the tree was?
    8·2 answers
  • Why Might People Be Against Cloning? (2+ complete sentences)
    13·1 answer
  • Development and the specialization of cells happens in unicellular organisms
    11·1 answer
  • Vance has just learned some new material for an electrical engineering class he is taking. Based on memory research, what is the
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!