Answer:
So, they do eat...they do reproduce...they are simple...and can move.
So if you were lazy and skipped a type of food mentioned or anything, please ask the entire question, with all the included words. This way I can evaluate from how/the way they say it.
<span>The major effects of insulin on muscle and adipose tissue are: (1) Carbohydrate metabolism: (a) it increases the rate of glucose transport across the cell membrane, (b) it increases the rate of glycolysis by increasing hexokinase and 6-phosphofructokinase activity, (c) it stimulates the rate of glycogen synthesis and decreases the rate of glycogen breakdown. (2) Lipid metabolism: (a) it decreases the rate of lipolysis in adipose tissue and hence lowers the plasma fatty acid level, (b) it stimulates fatty acid and triacylglycerol synthesis in tissues, (c) it increases the uptake of triglycerides from the blood into adipose tissue and muscle, (d) it decreases the rate of fatty acid oxidation in muscle and liver. (3) Protein metabolism: (a) it increases the rate of transport of some amino acids into tissues, (b) it increases the rate of protein synthesis in muscle, adipose tissue, liver, and other tissues, (c) it decreases the rate of protein degradation in muscle (and perhaps other tissues). These insulin effects serve to encourage the synthesis of carbohydrate, fat and protein, therefore, insulin can be considered to be an anabolic hormone.
I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
</span>
Answer:
Early cyanobacteria in stromatolites are thought to be responsible for increasing the amount of oxygen in the primeval Earth's atmosphere through their continuing photosynthesis. They were the first known organisms to photosynthesize and produce free oxygen.
Hope this helps!!!
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
The environment is affected by the biotic and abiotic factors such as temperature, pressure, humidity and organisms like human activity. Some factors that affect environment are the following : a) Greenhouse Effect - Green house gases like C O2, trap the heat from the sun that increase the temperature of the earth.
