1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
STatiana [176]
4 years ago
7

Nik needs to estimate how many books will fit in a bin. Each book is 1 ft tall, 0.5 ft wide, and 0.1 ft thick. The bin is 5 feet

wide, 2 feet tall, and 3 feet deep. Based on volume only, about how many books will fit in the bin?
Mathematics
1 answer:
yawa3891 [41]4 years ago
6 0

Answer:

600 books

Step-by-step explanation:

The bin's dimensions are

5 by 2 by 3

THe volume of the bin is the multiplication of the 3 dimensions given.

Volume of Bin = 5 * 2 * 3 = 30 cubic feet

Now, volume of each book would be gotten the same way. The dimensions of one book is:

1 by 0.5 by 0.1

Volume of 1 book = 1 * 0.5 * 0.1 = 0.05 cubic feet

The number of books that will fit in the bin would be:

30/0.05 = 600 books

You might be interested in
What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
Papessa [141]

Answer:

AATTGGCCATGCATGATTACGA

TTAACCGGTACGTACTAATGCT

Step-by-step explanation:

A's and T's, C's and G's. Just switch the letters for their partner.

8 0
3 years ago
Read 2 more answers
What value of n makes the equation true?
djverab [1.8K]
0.7n + 0.8n = 2.1
1.5n = 2.1 (add like terms(0.7+0.8=1.5))
n=2.1/1.5 (get en on its own)
n=1.40
3 0
3 years ago
The arithmetic mean of 10 consecutive even integers is 3. What is the least of these 10 even integers?
Lady bird [3.3K]

Answer:

-6

Step-by-step explanation:

2n can be the smallest integer, and 2n + 18 will be the largest integer.

The sum of this, divided by two, will result in the average/mean.

(2n + 2n + 18)/2 = 3

Multiply each side by 2:

(2n + 2n + 18)/2 ⋅ 2 = 3 ⋅ 2

2n + 2n + 18  =  6

Combine the like terms:

4n + 18 = 6

Subtract 18 from both sides:

4n + 18 - 18 = 6 - 18

4n = -12

Divide each side by 4:

4n/4 = -12/4

n = -3

Since we decided to go by 2n:

2n = 2(-3) = <u>-6</u>

6 0
4 years ago
Solvex3 + x2 – 1 = 0, correct to three decimal places by using fixed point<br> iteration method.
Finger [1]

Answer:

x3 + x2 - 1 = ( x 2 + 1) ( x + 1)

Step-by-step explanation:

8 0
3 years ago
Hellp me plz now yeyeyey
erastovalidia [21]

Answer:

step two

explanation:

the first 17.8 (-17.8) he was supposed to use was negative but the 17.8 (17.8) he used was not

7 0
3 years ago
Other questions:
  • Write an equation to represent the linear relationship the temperature of a pot of water is 72 degrees Fahrenheit the temperatur
    13·1 answer
  • Is 2/4 greater than 2/6
    10·2 answers
  • I do not know how to do this question?
    9·2 answers
  • A bag contains 40 marbles, 4 of which are blue, 10 are red, 25 are green, and 1 is purple. Shawna takes a marble out of the bag,
    12·1 answer
  • Reduce -10/-5 dont know how too reduce
    14·1 answer
  • If 12 cars are needed o get 36 students to the end of the road with their packs, how many cars will be able to carry 9 students
    6·2 answers
  • Which step is part of a proof showing the opposite sides of parallelogram ABCD are congruent?
    11·1 answer
  • How do I know how to determine whether a relation is a function? What is a function?
    6·2 answers
  • Use the tables to help you compare the two ratios.
    10·1 answer
  • 4. A ball is thrown with an initial velocity of 70 feet per second, at an angle of 35° with the horizontal. Find the vertical an
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!